Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012783947 Xl3.1-IMAGE:7979621.5 - 6 ESTs
                                                                       .-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7979621.5                                                                                                                                                                                                                                                                                          CAGGAGCAGCTCAGATACAGGTCTCTAAGAACAGTGTGTGATTGAGATCAGTTCATGGCTGCGTTGCCCCCGGGGATCCGTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGCTTTGGATATTTCTACAATATTCACAACCTGTCCTACTACATCATCATACAGGTACTGAATGGTTTGGTTCAGACCACCGGTTGGCCGAGCGTAGTCACCTGCATTGGAAACTGGTTTGGGAAAGGAAAGAGAGGCCTCATCATGGGAGTG
                                                  Xl3.1-CHK-1012702502                                                                                                                                                                                                                                                                                                CAGCTCAGATACAGGTCTCTAAGAACAGTGTGTGATTGAGACCAGTTCATGGCTGCGTTGCCCCCGGGGATCCGTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGCTTTGGATATTTCTACAATATTCACAACCTGTCCTACTACATCATCATACAGGTACTGAATGGTTTGGTTCAGACCACCGGTTGGCCGAGCGTAGTCACCTGCATTGGAAACTGGTTTGGGAAAGGAAAGAGAGGCCTCATCATGGGAGTGTGGAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                               2     4     2     4     2     4     3     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     4     6     3     5     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3
                                               BLH ATG      54     168                                                                                                                                                                                                                                                                                          
                                               BLH MIN      54      99                                                                                                                                                                                                                                                                                          
                                               BLH OVR      54     420                                                                                                                                                                                                                                                                                          
                                               ORF LNG      54       9                                                                                                                                                                                                                                                                                          
  5   1   2       add Emb1 5g                         IMAGE:6631178.5p CAGACGGACCCACACTGTGACTTACACAAAAGAGCTGGGTGCTGAGTTACACAGATCCTGCGTGCAGGGAAAGTGTTGGGTGCTGTGAGTAGGGAGAAGTTGGGTGCTGCTATACTGCTGGGTGCTGTGGGTAGACACAGGATTGGGTGCTGCCGGGGGGAGGAGGAGGAGGCGAGGCTGCAGGTGGTTAGGAGCTGAATGAGGAAGTAGAATAAAGTGACAGTTACTAAAGGAACCAGAACCCACAGACAGAGTCACCGGGAGACCTGCCCAGAGTCACACGCAGTCTACCAGGAGCAGCACAAATACAGGAACCTTGTGCCTGAGACCAGTTCATGGCTGCGCTGCCTCCGGGGATCCGTCTCTTCTTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTCACCTTCCTGATTTATTGCAGCTTTCATTTGTCTCGAAAGCCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACATGAGGTCGAGCTCCACAGTTACAAGGAGTTTGTTATTCTCAATCAAGGGCCCCTTCACTCAGTTCAGAATGCATCTCGCTGTGGTTGGGCCCCCGTTGATAAGAAGAATTACAACCAGCTCCTGGGGGCTTTGGACTATTCCTTCCTGTGCGCCTATGCTATTGGCATGTTCCTCAGTGGGATGATTGGGGGAACCCCTTGGCCTCTCAGGGAACTTCCCTCTTCCTGGGGGGATGTTGGGCCAGTTGGCTTTATTCCCAGGGGCCTCTCTGGCTTTTGGAACATTTTCTTCCAATAATAACG
  5   1   2       bld Emb3 5x3  out                   IMAGE:3400281.5p                                                                                                                                                                                                                                                      AGGAACCTACAGACAGAGCCACACGCAGACTCCCAGGAGCAGCTCAGATACAGGTCTCTAAGAACAGTGTGTNNGATTGAGATCAGTTCATGGCTTGCGTTGCCCCCGGGGATCCGTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAAGTATTTCCTCTCCTGCGGGATGTTGGGCAGTGGCTTATTTACCTGCCCTATTTGGCTTTGGATATTTCTA
  5   1   2       bld Emb4 5g                         IMAGE:5537165.5p                                                                                                                                                                                                                                                             ACCTACAGACAGAGCCACACGCAGACTCCCAGGAGCAGCTCAGATACAGGTCTCTAAGAACAGTGTGTGATTGAGATCTGTTCATGGCTGCGTTGCCCCCGGGGATCCGTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGCTTTGGATATTTCTACAATATTCACAACCTGTCCTACTACATCATCATACAGGTACTGAATGGTTTGGTTCAGACCACCGGTTGGCCGAGCGTAGTCACCTGCATTGGAAACTGGTTTGGGAAAGGAAAGAGAGGCCTGCATCATGGGGAGTGTGGAACTCACACACATCAGTGGGCAACATCCTGNGCTCTCTTATTGCTGGGATACTGGGTGTCAACTTGGCTGGGGGAATGTTCCTTCTTGGNTGGCCGGAATGATCATTCTCCTTCATGGGGCATCATCTGCTTTCCTCTTCCCTTGTAGAGCATCCCCCAGGATATTAAAGTCTTGAGGCCACACCAAGCCCCCTCAAGGGTTGCCCATTGGTATATTAAAAGTCCCGAAAACCAAGTTACCTACCCGAATGGACCAGAAGGCTCCGGGGACAGCAACCAGGGAAGTTTTTCCAGGGAA
  5   1   2       bld Em10 5g                         IMAGE:7979621.5p                                                                                                                                                                                                                                                                                CGCAGACTCCCAGGAGCAGCTCAGATACAGGTCTCTAAGAACAGTGTGTGATTGAGATCAGTTCATGGCTGCGTTGCCCCCGGGGATCCGTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGCTTTGGATATTTCTACAATATTCACAACCTGTCCTACTACATCATCATACAGGTACTGAATGGTTTGGTTCAGACCACCGGTTGGCCGAGCGTAGTCACCTGCATTGGAAACTGGTTTGGGAAAGGAAAGAGAGGCCTCATCATGGGAGTGTGGACTCACACACATCAGTGGGCACATCTGGGCTCTCTATTGCTGGAACTGGTGTCAACTGCTGGGGATGTCTTCTGTGCCNGATGATACTCTCATGGATCACGCTCTCTCTGTAAGATCCAGATTCATCGAGCACCACCTCAGTGCTGATTAATCGACATCTCAAGCAGCCGACA
  5   1   2      seed Emb4                   IMAGE:5537165-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                         GTCTCTTCGTGTCCCTGTCCCGGGATCAGTGGTTTCGGGCTCTGGTTCTGGTTCTGACCTTTCTGTTTTACTGCAGCTTTCATCTGTCCCGAAAACCAATCACAATAGTGAAGGGGGAGCTGCACAGACATTGCTCAGAGCCACACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGC
  5   1   2       bld Int2                            IMAGE:8527474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGAGGTTGAGCTCCACAGTTACAAGGAGTTTGTGATTCACAATCAGGGGCCCCTTTACTCAGAGCAGAATGCGTCTCGCTGCGGCTGGGCCCCATTTGATAAAAAGAATTATAAGCAGCTCCTGGGGGCTCTGGACTATTCCTTCCTCTGCGCCTATGCCATTGGCATGTTCCTCAGTGGGATGATCGGGGAGCGCTTGCCTCTCAGGTATTTCCTCTCCTGCGGGATGTTGGCCAGTGGCTTATTTACTGCCCTATTTGGCTTTGGATATTTCTACAATATTCACAACCTGTCCTACTACATCATCATACAGGTACTGAATGGTTTGGTTCAGACCACCGGTTGGCCGAGCGTAGTCACCTGCATTGGAAACTGGTTTGGGAAAGGAAAGAGAGGCCTCATCATGGGAGTGTGGAACTCACACACATCAGTGGGCAACATCCTGGGCTCTCTTATTGCTGGATACTGGGTGTCAAACTGCTGGGGGATGTCCTTCTTGGTGCCCGGAATGATCATCTCCTTCATGGGCATCATCTGCTTCCTCTTCCTTGTAGAGCATCCCCAGGATATCAAGTCTGAGGCCACACCAGCCCCTCAAGGTTGCCATGTATATAAAGTCCAGAACAAGTTACTACAGATGGCAGAGGCTCCGGAGCAACAGGAGTTTCAGGACATGCTTGGACCTTCTCCCATCTATCCCACCCATCATGTCATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)