Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Sep 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6951367.5                       5 END     2          40       40                hypothetical protein LOC100127879 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012784207 Xl3.1-IMAGE:6951367.3 - 5 ESTs
                                                                       .........-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6951367.3                                                                                                                                                                                                                                                ATCAATCTAGAGACTGAAGGCTTGGCTGTAAAGAAATGTACAGNAAATATATACTCCTGAAAGAGAGAATATAAATAGTGGGTTAGACATCTAGGGAGCAGTCATGAGAAGAACATGAAGATTCTAGCAACTGTCCCTACTCGTGGCCGCATGGTGATGCTAAATAGTCCACTAATCCAGGCTGCCAAAATAAGATTGAATATACTCCTCTGAATTTACTTTTAACCCCTTCTTGAGCAGGATTCTCAGAAAATTAAGGGATTAAAAACCTTCCTGTATCCCAACATAACATCAATTTGGCATCAGGAGACCAGAGGTGGAAATTTGATTGGATATCAGATGGATGCTGAGAAATGGATCTGTGCAGCACTTTGGAGTACTCAAAATCATAGTGTTTAAAGGAATCTACAATCAAGAGTTTATTGTTTCCTTATGCGACATTCACATACTTTCATTTTTTTTGTATCGTCTTCAATCATTTCCATCTTACTCTGCTTTGCTGTAGCACCCCTCACAGAGGAAGAGAGGTTGAGGCTGCTGCTCTGCACATATACATTGCTTGGATACATTTTATGACTTTATTTTCCAAATTTCTAGCACCTTTAAATGTCATTTGAAGTGTTCCCATTGGGTTAATGATTATACTTAGAAAGCTTTGGTCATACGTAAATGAGAACGGTGGGTTACACCAGGCAC
                                                  Xl3.1-CHK-1012704551                                                                                                                                                                                                                                                      CTAGAGACTGAAGGCTTGGCTGTAAAGAAATGTACAxGAAAxxxxxxxTCCTGAAAGAGAGAATATAAATAGTGGGTTAGACATCTAGGGAGCAGTCATGAGAAGAACATGAAGATTCTAGCAACTGTCCCTACTCGTGGCCGCATGGTGATGCTAAATAGTCCACTAATCCAGGCTGCCAAAATAAGATTGAATATACTCCTCTGAATTTACTTTTAACCCCTTCTTGAGCAGGATTCTCAGAAAATTAAGGGATTAAAAACCTTCCTGTATCCCAACATAACATCAATTTGGCATCAGGAGACCAGAGGTGGAAATTTGATTGGATATCAGATGGATGCTGAGAAATGGATCTGTGCAGCACTTTGGAGTACTCAAAATCATAGTGTTTAAAGGAATCTACAATCAAGAGTTTATTGTTTCCTTATGCGACATTCACATACTTTCATTTTTTTTGTATCGTCTTCAATCATTTCCATCTTACTCTGCTTTGCTGTAGCACCCCTCACAGAGGAAGAGAGGTTGAGGCTGCTGCTCTGCACATATACATTGCTTGGATACATTTTATGACTTTATTTTCCAAATTTCTAGCACCTTTAAATGTCATTTGAAGTGTTCCCATTGGGTTAATGATTATACTTAGAAAGCTTTGGTCATACGTAAATGAGAACGGTGGGNTACACCAGGCACCTAGGT
                                                      consensus depths                                                                                                                                                                                                                                                     2     3     2     3     3     4     3     4     2     4     4     4     4     4     4     4     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     3     5     5     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     4     5
                                                 Xl3.1-IMAGE:6951367.3                                                                                                                                                                                                                                                                                                         TGA---------------TAG------------------------------------ATG---------------------------------ATG---ATG---------------------------------------------------TGA---------TAA------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TAA---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TAG------TAAATG------------------------TAATGA---------------------------TAAATG
  3   1   2       bld Int2                            IMAGE:8820888.3p CTGGCGGAACTTCTTTAACACCCTTCCCGGGATGCTACCACCGGACAGAATGTATGATCTTGGGCAGTGGTAGTCATGGCGGAAGTGACAAATCGTGAACATACATTACATGTAAAAAGCATGATCTGGTTGTTGTTTGACGACGAATATGTAGAGAAAATCGATGCACAAGCCATTGAGGAATTCTATGGTTTGACATCTGACATTTCCAAAAACTCTGAGTCCGGTTATATCTGTTCTATCAATCTAGAGACTGAAGGCTTGGCTGTAAAGAAATGTACAGAAAATATATACTCTGAAAGAGAGAATATAAATAGTGGGTTAGACATCTAGGGAGCAGTCATGAGAAGAACATGAAGATTCTAGCAACTGTCCCTACTCGTGGCCGCATGGTGATGCTAAATAGTCCACTAATCCAGGCTGCCAAAATAAGATTGAATATACTCCTCTGAATTTACTTTTAACCCCTTCTTGAGCAGGATTCTCAGAAAATTAAGGGATTAAAAACCTTCCTGTATCCCAACATAACATCAATTTGGCATCAGGAGACCAGAGGTGGAAATTTGATTGGATATCAGATGGATGCTGAGAAATGGATCTGTGCAGCACTTTGGAGTACTCAAAATCATAGTGTTTAAAGGAATCTACAATCAAGAGTTTATTGTTTCCTTATGCGACATTCACATACTTTCATTTTTTTTGTATCGTCTTCAATCATTTCCATCTTACTCTGCTTTGCTGTAGCACCCCTCACAGAGGAAGAGAGGTTGAGGCTGCTGCTCTGCACATATACATTGCTTGGATACATTTTATGACTTTATTTTCCAAATTTCTAGCACCTTTAAATGTCATTTGAAGTGTTCCCATTGGGTTAATGATTATACTTAGAAAGCTTTGGTCATACGTAAATGAGAACGGTGGGTCACACCAGGCACCCAGCAAAGCAGAGTAAGATGAAAAGAT
  3   1   2       bld Brn1 5g3  out                   IMAGE:6951367.3p                                                                        TGGACCCAAATCGGTGGCCCTTACATTACCCATGAAAAAAAGCCCAGGGTTTCGGGTTGTTTTTGACGGACGATATTGTAGAGAAAATCGATGCACAAGCCATTGAGGAATTCTATGGTTGGACATCTGACATTTCCAAAAACTCTGAGTCCGGTTATATCCTGTTCTATCAATCTAGAGACTGAAGGCTTGGCTGTAAAGAAATGTACAGAAAATATATACTCCTGAAAGAGAGAATATAAATAGTGGGTTAGACATCTAGGGAGCAGTCATGAGAAGAACATGAAGATTCTAGCAACTGTCCCTACTCATGGCCGCATGGTGATGCTAAATAGTCCACTAATCCAGGCTGCCAAAATAAGATTGAATATACTCCTCTGAATTTACTTTTAACCCCTTCTTGAGCAGGATTCTCAGAAAATTAAGGGATTAAAAACCTTCCTGTATCCCAACATAACATCAATTTGGCATCAGGAGAACAGAGGTGGAAATTTGATTGGATATCAGATGGATGCTGAGAAATGGATCTGTGCAGCACTTTGGAGTACTCAAAATCATAGTGTTTAAAGGAATCTACAATCAAGAGTTTATTGTTTCCTTATGCGACATTCACATACTTTCATTTTTTTTGTATCGTCTTCAATCATTTCCATCTTACTCTGCTTTGCTGTAGCACCCCTCGCAGAGGAAGAGAGGTTGAGGCTGCTGCTCTGCACATATACATTGCTTGGATACATTTTATGACTTTATTTTCCAAATTTCTAGCACCTTTAAATGTCATTTGAAGTGTTCCCATTGGGTTAATGATTATACTTAGAAAGCTTTGGTCATACGTAAATGAGAACGGTGGGTTCACCAGGCACCATGG
  3   1   2       add Ga12                                 XL194n09.3p                                                                                                                                                                                                                                GGTTATATCNTGTTCTATCAATCTAGAGACTGAAGGCTTGGCTGTAAAGAAATGTACAGNAAATATATNCTCNTGAAAGAGAGANTATAAATAGTGGGTTAGNCATCTAGGGAGCAGTCATGAGAAGAACATGAAGATTCTAGCAACTGTCCNTACTCGTGGCCGCATGGTGATGCTAAATAGTCCANTAATCCAGGCTGCCAAAATAAGATTGAATATACTCCTNTGAANNTANTTTTAACCCNTTNTTGAGCAGGATTCTCAGAAAATTAAGGGATTAAAAACCTTCCTGTATCCCAACATAACATCAATTTGGCATCAGGAGACCAGAGGTGGAAATTTGATTGGATATCAGATGGATGNTGAGAAATGGATCTGNGCAGCACTTTGGAGTACTCAAAATCATAGTGTTTAAAGGAATNTACAATCAAGAGTTTATTGTTTCCTTATGCGACATTCACATACTTTCATTTTTTTTGTATCGTCNTCAATCATTTCCATCTTACTNTGCTNNGCTGTAGCACCCCTCACAGAGGAAGAGAGGTTGAGGCTGCTGCTCTGCACATATACATTGCTTGGATACATTTTATGACNTTATTTTCCAAATTTNTAGCACCTTTAAATGTCATCNGAAGTGTTCCCATTGGGTTAATGATTATACTTAGAAAGCTTNGGTCATACGTAAATGAGAACGGTGGGNTACACCAGGCACC
  3   1   2       add Ga12                                 XL201o24.3p                                                                                                                                                                                                                                                                   GCTTGGCTGTAAAGAAATGTACAGNAAATATATNCTCCTGAAAGAGAGAATATAAATAGTGGGTTAGNCATCTAGGGAGCAGTCATGAGAAGAACATGAAGATTCTAGCAACTGTCCCTACTCGTGGCCGCATGGTGATGCTAAATAGTCCACTAATCCAGGCTGCCAAAATAAGATTGAATATACTCCTNTGAATNTANTTTTAACCCNTTNTTGAGCAGGATTCTCAGAAAATTAAGGGATTAAAAACCTTCCTGTATCCCAACATAACATCAATTTGGCATCAGGAGACCAGAGGTGGAAATTTGATTGGATATCAGATGGATGNTGAGAAATGGATCTGNGCAGCACTTTGGAGTACTCAAAATCATAGTGTTTAAAGGAATNTACAATCAAGAGTTTATTGTTTCCTTATGCGACATTCACATACTTTCATTTTTTTTGTATCGTCTTCAATCATTTCCATCTTACTNTGCTNNGCTGTAGCACCCCTCACAGAGGAAGAGAGGTTGAGGCTGCTGCTCTGCACATATACATTGCTTGGATACATTTTATGACTTTATTTTCCAAATTTNTAGCACCTTTAAATGTCATNTGAAGTGTTCCCATTGGGTTAATGATTATACTTAGAAAGCTTTGGTCATACGTAAATGAGAACGGTGGGNTACACCAGGCACCTAGGTGTTTGTTCTTTAGCTCATAA
  3   1   2      seed Neu7      out                        XL034h03.3p                                                                                                                                                                                                                                                                                                                                           TAGGGAGCAGTCATGAGAAGAACATGAAGATTCTAGCAACTGTCCCTACTCGTGGCCGCATGGTGATGCTAAATAGTCCACTAATCCAGGCTGCCAAAATAAGATTGAATATACTCCTCTGAATTTACTTTTAACCCCTTCTTGAGCAGGATTCTCAGAAAATTAAGGGATTAAAAACCTTCCTGTATCCCAACATAACATCAATTTGGCATCAGGAGACCAGAGGTGGAAATTTGATTGGATATCAGATGGATGCTGAGAAATGGATCTGTGCAGCACTTTGGAGTACTCAAAATCATAGTGTTTAAAGGAATCTACAATCAAGAGTTTATTGTTTCCTTATGCGACATTCACATACTTTCATTTTTTTTGTATCGTCTTCAATCATTTCCATCTTACTCTGCTTTGCTGTAGCACCCCTCACAGAGGAAGAGAGGTTGAGGCTGCTGCTCTGCACATATACATTGCTTGGATACATTTTATGACTTTATTTTCCAAATTTCTAGCACCTTTAAATGTCATTTGAAGTGTTCCCATTGGGTTAATGATTATACTTAGAAAGCTTTGGTCATACGTAAATGAGAACGGTGGGTTACACCAGGCACCTAGGTGTTTTGTTCTTTAGCTCATTAAACCGATATGACACCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)