Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.6699999999999999    0Xl3.1-xlk143e12ex.3                         7 END     3          60       42                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8528261.5                      18 PI      91        568     1080                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:5154831.5                       9 PI      94          2      689                (no blast hit)

 This cluster: approximate FL confidence score = 45%

 1012784287 Xl3.1-IMAGE:6325381.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6325381.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCTCAGGCACATTGAAATTAACGGCAGCAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTAAAGTTGAGGACAATAAACCTGCGCTTCTGGCCTCCCCTTTACAACTGGAAATTATCATCTACTGCACGGGGGCTGCTTTTGTGTCCGCAATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAACTGGCTGTGCACAAGCTTGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAGCTCATCAATGAACTCTGGAGTGATATTAGTCAGACGCCTTTCTTCCAGTGGGACTCCCATGTTGTCTGGACTATCGGAATATGAGCTTCCAGAAGATCCACGATGGGAAGTGGCAAGGGACAGACTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAAGTAGTCATGGCGGAGGCTATGGCCTGGACAAGGAGAAGCCTAACAAAGTAACAAAAGTTGCTGTGAAGATGTTGAAGTCTGATGCGAGTGAAAAGGACCTGTCGGATCTGATTTCCGAGATGGAAATGATGAAAATGATTGGAAAACACAAAAATATAATTAATTTACTTGGTGCCTGCACCCAAGATGGTCCACTCTATGTAATTGTCGAATACACTTCCAAGGGGAATCTGAGAGAGTACTTACGGGCCAGGNGCCGCGCCGGGCATGGAACTGCTACAACCCTACCTGTGTCCCCGATCAGCTGCTTTCCTTCAAAGATCTGGTGTCATGTGCTTACCAGGGGTGGCACGTGGGGACTACCTAGCCTCTAAAAAGTGGCATCCACAGAGGACCTGGCTGCAGGAATGTTTTAGTAACAGAGGACAACATAATGAAGATTGCCGATTTCGNTTAGCCCGTGACATCCATCACAT
                                                  Xl3.1-CHK-1012703404                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCACATTGAAATTAACGGCAGCAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTAAAGTTGAGGACAATAAACCTGCGCTTCTGGCCTCCCCTTTACAACTGGAAATTATCATCTACTGCACGGGGGCTGCTTTTGTGTCCGCAATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAACTGGCTGTGCACAAGCTTGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAGCTCATCAATGAACTCTGGAGTGATATTAGTCAGACGCCTTTCTTCCAGTGGGACTCCCATGTTGTCTGGACTATCGGAATATGAGCTTCCAGAAGATCCACGATGGGAAGTGGCAAGGGACAGACTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAAGTAGTCATGGCGGAGGCTATxGxCxxGACAAGGAGAAGCCTAACAAAGTAACAAAAGTTGCTGTGAAGATGTTGAAGTCTGATGCGAGTGAAAAGGACCTGTCGGATCTGATTTCCGAGATGGAAATGATGAAAATGATTGGAAAACACAAAAATATAATTAATTTACTTGGTGCCTGCACCCAAGATGGTCCACTCTATGTAATTGTCGAATACACTTCCAAGGGGAATCTGAGAGAGTACTTACGGGCCAGGGxxCxCGCCGGGxxxGxAxxxxxxACAACCCTACCTGTGTCCCCGATCAGCTGCTTTCCTTCAAAGATCTGGTGTCATGTGCTTACCAGGxGxxxCACGTGGGxxxxAxCxxxxCxxxxAAAAGTGxxxxCxxxxxxxGACCTGxxxxxAGGAATGTTTTAGTAACAGAGGACAACATAATGAAGATTGCCGATTTCGNTTAGCCCGTGACATCCATCACATTGACTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3
                                               BLH MIN     618       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     540     143                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ce ---- 1e-008     NP_504458.1 C24G6.2a [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 9e-012     XP_001202828.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 2e-013     NP_608762.2 CG3277-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 1e-047     Q4H3K6 Fibroblast growth factor receptor precursor (Ci-FGFR) [Ciona intestinalis]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                             PREDICTED - ?? ---- 5e-076     XP_001789758.1 PREDICTED: fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 2e-080     NP_694494.1 fibroblast growth factor receptor 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                PREDICTED - Cf ---- 8e-089     XP_848780.1 PREDICTED: similar to fibroblast growth factor receptor 1 isoform 1 precursor isoform 3 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                      PROTEIN --- Mm ---- 2e-091     NP_001073377.1 fibroblast growth factor receptor 1 isoform 2 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                PROTEIN --- Hs ---- 1e-091     NP_075598.2 fibroblast growth factor receptor 1 isoform 1 precursor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                      PROTEIN --- Bt ---- 8e-092     NP_001103677.1 fibroblast growth factor receptor 1 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                      PROTEIN --- Gg ---- 2e-094     NP_990841.1 cek1 protein [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                            PROTEIN --- Xt ---- 5e-110     CAJ82801.1 ibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 9e-115     NP_001081338.1 fibroblast growth factor receptor [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6325381.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------TAA------------TGA------TGA------ATG------------------------TGA---------------TGATGA---TGA------------------TAA---------------------------ATG---------ATGTAA---------------------------TGA------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Neu7      out                        XL005c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTGCAAAGTGTACAGCGACCCCCAGCCTCACATCCAATGGCTCAGGCACATTGAAATTAACGGCAGCAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTAAAGTTGAGGACAATAAACCTGCGCTTCTGGCCTCCCCTTTACAACTGGAAATTATCATCTACTGCACGGGGGCTGCTTTTGTGTCCGCAATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAACTGGCTGTGCACAAGCTTGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAGCTCATCAATGAACTCTGGAGTGATATTAGTCAGACGCCTTTCTTCCAGTGGGACTCCCATGTTGTCTGGACTATCGGAATATGAGCTT
  5   1   2      seed Neu7 5g                              XL015h03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCTCAGGCACATTGAAATTAACGGCAGCAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTAAAGTTGAGGACAATAAACCTGCGCTTCTGGCCTCCCCTTTACAACTGGAAATTATCATCTACTGCACGGGGGCTGCTTTTGTGTCCGCAATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAACTGGCTGTGCACAAGCTTGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAGCTCATCAATGAACTCTGGAGTGATATTAGTCAGACGCCTTTCTTCCAGTGGGACTCCCATGTTGTCTGGACTATCGGAATATGAGCTTCCAGAAGATCCACGATGGGAAGTGGCAAGGGACAGACTGATCCTT
  5   1   2       bld Egg3 5g                         IMAGE:6325381.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGATTCCCCGGGCCCGGGGCTCTCATCATTCTGCATGGTTGACCGTTCTTAAAGTTGAGGACAATAAACCTGCGCTTCTGGCCTCCCCTTTACAACTGGAAATTATCATCTACTGCACGGGGGCTGCTTTTGTGTCCGCAATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAACTGGCTGTGCACAAGCTTGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAGCTCATCAATGAACTCTGGAGTGATATTAGTCAGACGCCTTTCTTCCAGTGGGACTCCCATGTTGTCTGGACTATCGGAATATGAGCTTCCAGAAGATCCACGATGGGAAGTGGCAAGGGACAGACTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAAGTAGTCATGGCGGAGGCTATTGGCCTGGACAAGGAGAAGCCTAACAAAGTAACAAAAGTTGCTGTGAAGATGTTGAAGTCTGATGCGAGTGAAAAGGACCTGTCGGATCTGATTTCCGAGATGGAAATGATGAAAATGATTGGAAAACACAAAAATATAATTAATTTACTTGGTGCCTGCACCCAAGATGGTCCACTCTATGTAATTGTCGAATACACTTCCAAGGGGAATCTGAGAGAGTACTTACGGGCCAGGCGCCCGCCGGGCATGGAGTACTGCTACAACCCTACCTGTGTCCCCGATCAGCTGCTTTCCTTCAAAGATCTGGTGTCATGTGCTTACCAGGTGGCACGTGGGATGGACTACCTAGCCTCTAAAAGTGCATCCACAGAGACCTGGCTGCAAGGAATGTTTTAGTAACAGAGGGACACATAATGAAGATTGCCGATTTTCGGCTTAGCCCGTGACATCCATCACATTTGACTATTATAAGGAAAACG
  5   1   2       bld Ga18 5g3  out                      xlk58g01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAGGGGNNTCCAGCTCATCAATGAACTCTGGAGTGATATTAGTCAGACGCCTTTCTTCCAGTGGGACTCCCATGTTGTCTGGACTATCGGAATATGAGCTTCCAGAAGATCCACGATGGGAAGTGGCAAGGGACAGACTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAAGTAGTCATGGCGGANNNNTTGGCCTGGACAAGGAGAAGCCTAACAAAGTAACAAAAGTTGCTGTGAAGATGTTGAAGTCTGATGCGAGTGAAAAGGACCTGTCGGATCTGATTTCCGAGATGGAAATGATGAAAATGATTGGAAAACACAAAAATATAATTAATTTACTTGGTGCCTGCNCCCAAGATGGTCCACTCTATGTAATTGTCGAATACACTTCCAAGGGGAATCTGAGAGAGTACTTACGGGCCAGGNGCCCGCNNNNNGGAGTACTGCTACAACCCTACCTGTGTCCCCGATCAGCTGCTTTCCTTCAAAGATCTGGTGTCATGTGCTTACCAGGTGGCACGTGGNNNGGACTACCTAGCCTCTAAAAAGTGCATCCACAGAGANCTGGCTGCAANGNAANGTTTTAGTAACAGAGGACAACATAATGAAGATTGCCGATTTCGNTTAGCCCGTGACATCCATCACATTGACTANNNAAGAAACGACAAATNGNCCGGCTGCCTGTAAATGGNNNNCCCCAGNNGNNNTNNTTGACC
  5   1   2       bld Ga18 5g3  out                      xlk59g01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAGGGGNNTCCAGCTCATCAATGAACTCTGGAGTGATATTAGTCAGACGCCTTTCTTCCAGTGGGACTCCCATGTTGTCTGGACTATCGGAATATGAGCTTCCAGAAGATCCACGATGGGAAGTGGCAAGGGACAGACTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAAGTAGTCATGGCGGANNNNTTGGCCTGGACAAGGAGAAGCCTAACAAAGTAACAAAAGTTGCTGTGAAGATGTTGAAGTCTGATGCGAGTGAAAAGGACCTGTCGGATCTGATTTCCGAGATGGAAATGATGAAAATGATTGGAAAACACAAAAATATAATTAATTTACTTGGTGCCTGCACCCAAGATGGTCCACTCTATGTAATTGTCGAATACACTTCCAAGGGGAATCTGAGAGAGTACTTACGGGCCAGGNGCCGCCGNNNNNGGAGTACTGCTACAACCCTACCTGTGTCCCCGATCAGCTGCTTTCCTTCAAAGATCTGGTGTCATGTGCTTACCAGGTGGCACGTGGNANGGNCTACCTAGCCTCTAAAAAGNGCATCCACAGAGANCTGGCTGCAAGGAATGTTTTAGTAACAGAGGACAACATAATGAAGATTGCCGATTTCGNTTAGCCCGTGACATCCATCACATTGACTNNTATNNGAAAACGNNNAATGGNCGGCTGCCTGTAAANGNNNNGNCCCAGNNNNNNCTGTTTGACCGGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)