Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL210n21.5                            2 PI      94          1      591                at rich interactive domain 4a (rbp1 like) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012784308 Xl3.1-xlk106a10ex.3 - 8 ESTs
                                                                       .........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk106a10ex.3                              GTTGTAGTGAAGACAAATCTTCGAGCTGGAATCCCTCAAATAACCTTTGACGATGAAGGCAGTGGATGAGCCTGCCTACCTAACAGTGGGGACTGATGTTAGTGCCAAGTACCGGGGGGCCTTCTGTGAGGCAAAAATCAAGACCGTAAAAAGGCTGGTAAAAGTCAAGGTTACTCTGAAGCCAGATAACTCTACTCAGCTTGTCCAGGATGACCAAGTGAAAGGACCTTTAAGAGTTGGTGCAACAGTTGAAATGAAAACAACTGATGGATCCCCGCAGGAAGCCATTATTAGTAAATTGACGGATGCAAGCTGGTATACAGTAGTTTTTGATGATGGTGATGAAAAGACATTACGGAGAACATCATTGTGTTAAAAGGGGAGGAGGCATTTTGCGAAAGTGAGACTTCTGGACCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAGTAATTGGTAAAAAAACCAACAGGGGAAGGAGATCGTCTCTTCCAATGACTGAAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTTAAAGCGCCTTAATGATGAACTATTGGGCAAAATAGTCAGTGTGAAATGCAGTCCATCTAAAGAATGGTTTACAGCACTGGTTGTATCTCCAAGCTGTAGTGATGACACTGCTGTAAAAAAGGACCAGTGTTTGGTTCGCTCGTTGGTTGACTCAAAGTTTCATTCAGTTGCAAGGAAAGATCTTACTGAACTTGATGTCGATGTCTTAAAGTCGGAGCATTGTGGAAAGCAAGGTGTACAGGACGCCATTGCCTTTCTGACATCCAGGATAATCCCTGAGAAATGGAAAATGGACATGAGTGAAATCCTTGAATCTTCCAGCAGCGATGAAGAAGCTGGAGAGGAGGATGCTAGCGACAGTGATCAGAACAAAGAAGAAGAGGAAGAAACTCAGCTTGAAGAGGAGGCAGATCCAGCAGAGAGAGACAACTTCCTTCAGCAGCTCTACAAGTTTATGGAAGACAGAGGTAAAGTTATAACGCGAATGATTTAAATACATCGAGTCAAGTGTAAATGACAGTGAGCACAACTTCACACGAGTCTTGTTTCTATTAGTAACATTGGTAAAACAGCTGCATTAAAGACGCAACATCATCATGGAAT
                                                  Xl3.1-CHK-1012697997                                    GTGAAGACAAATCTTCGAGCTGGAATCCCTCAAATAACCTTTGACGATGAAGGCAGTGGATGAGCCTGCCTACCTAACAGTGGGGACTGATGTTAGTGCCAAGTACCGGGGGGCCTTCTGTGAGGCAAAAATCAAGACCGTAAAAAGGCTGGTAAAAGTCAAGGTTACTCTGAAGCCAGATAACTCTACTCAGCTTGTCCAGGATGACCAAGTGAAAGGACCTTTAAGAGTTGGTGCAACAGTTGAAATGAAAACAACTGATGGATCCCCGCAGGAAGCCATTATTAGTAAATTGACGGATGCAAGCTGGTATACAGTAGTTTTTGATGATGGTGATGAAAAGACATTACGGAGAACATCATTGTGTTTAAAGGGGAGxxGxxxTTTxxxGAAAGTGAGACTxxxGxxCCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAGTAATTGGTAAAAAAACCAACAGGGGAAGGAGATCGTCTCTTCCAATGACTGAAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTTAAAGCGCCTTAATGATGAACTATTGGGCAAAATAGTCAGTGTGAAATGCAGTCCATCTAAAGAATGGTTTACAGCACTGGTTGTATCTCCAAGCTGTAGTGATGACACTGCTGTAAAAAAGGACCAGTGTTTGGTTCGCTCGTTGGTTGACTCAAAGTTTCATTCAGTTGCAAGGAAAGATCTTACTGAACTTGATGTCGATGTCTTAAAGTCGGAGCATTGTGGAAAGCAAGGTGTACAGGACGCCATTGCCTTTCTGACATCCAGGATAATCCCTGAGAAATGGAAAATGGACATGAGTGAAATCCTTGAATCTTCCAGCAGCGATGAAGAAGCTGGAGAGGAGGATGCTAGCGACAGTGATCAGAACAAAGAAGAAGAGGAAGAAACTCAGCTTGAAGAGGAGGCAGATCCAGCAGAGAGAGACAACTTCCTTCAGCAGCTCTACAAGTTTATGGAAGACAGAGGTAAAGTTATAACGCGAATGATTTAAATACATCGAGTCAAGTGTAAATGACAGTGAGCACAACTTCACACGAGTCTTGTTTCTATTAGTAACATTGGTAAAACAGCTGCATTAAAGACGCAACATCATCATGGAATGCCATA
                                                      consensus depths                                   2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     4     7     4     7     4     7     4     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     7     4     7     4     7     5     7     5     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG      52     984                              
                                               BLH MIN      28     160                              
                                               BLH OVR      52     877                              
                                                                       PROTEIN --- Ce ---- 3e-027     NP_001041181.1 Y108G3AL.7 [Caenorhabditis elegans] -----=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Ci ==== 5e-050     NP_001072026.1 Retinoblastoma-binding protein [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                         PREDICTED - Sp ---- 4e-061     XP_001184414.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Dm ==== 5e-064     NP_001097025.1 CG34422 CG34422-PB, isoform B [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Ag ==== 6e-066     XP_308373.4 AGAP007503-PB [Anopheles gambiae str. PEST] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PREDICTED = Dr ==== 2e-125     NP_001026838.1 hypothetical protein LOC327404 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PREDICTED = Cf ==== 2e-131     XP_537461.2 PREDICTED: similar to retinoblastoma-binding protein 1 isoform I isoform 1 [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PREDICTED = Bt ==== 5e-134     XP_878256.1 PREDICTED: similar to retinoblastoma-binding protein 1 isoform III isoform 4 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Hs ==== 3e-134     NP_075377.2 retinoblastoma-binding protein 1 isoform III [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Mm ==== 1e-134     NP_001074664.1 retinoblastoma-binding protein 1 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Gg ==== 2e-136     NP_001012920.1 retinoblastoma-binding protein 1 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Xt ==== 2e-163     CAJ82688.1 at rich interactive domain 4a (rbp1 like) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PREDICTED = Xl ==== 0          NP_001090096.1 hypothetical protein LOC735171 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk106a10ex.3                                  TAGTGA------------------------------TAA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---TAA---------------------TGA---TGA
                                                                   ORF                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                            ]
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2      skin Ga18      in                      xlk106a10ex.5p              AGCAGCCANNNNNATTGTTGTAGTGAAGACAAATCTTCGAGCTGGAATCCCTCAAATAACCTTTGACGATGAAGGCAGTGGATGAGCCTGCCTACCTAACAGTGGGGACTGATGTTAGTGCCAAGTACCGGGGGGCCTTCTGTGAGGCAAAAATCAAGACCGTAAAAAGGCTGGTAAAAGTCAAGGTTACTCTGAAGCCAGATAACTCTACTCAGCTTGTCCAGGATGACCAAGTGAAAGGACCTTTAAGAGTTGGTGCAACAGTTGAAATGAAAACAACTGATGGATCCCCGCAGAAGCCATTATTAGTAAATTGACGGATGCAAGCTGGTATACAGTAGTTTTTGATGATGGTGATGAAAAGACATTACGGAGAACATCATTGTGTTTAAAAGGGGAGAGGNATTTTGCAGAAAGTGAGACTCTGGACCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAGTAATTGGTAAAAAAACCAACAGGGGAAGGAGATCGTCTCTTCCAATGACTGAAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTTAAAGCGCCTTAATGATGAACTATTGGGCAAAATAGTCAGTGTGAAGNGCAGTTCATCTAAGGANNGGNTTACAGCACTGGNTGTATCTCCAAGCTGTAGTGATGACACTGCTNTAAAAAAGGNNCAGNNTTTGGTNNGCTCGTTNGNTNANTCAAAGTTTCATTCAGTTGCAAGG
  5   1   2       add Te2  5g3  in                    IMAGE:7391567.5p                  TAGGAGCCGAGTGTTTGTAGTGAAGAAAATCTTCGAGCTGGAATCCCTCAAATAACCTTTGACGATGAAGGCAGTGGATGAGCCTGCCTACCTAACAGTGGGGACTGATGTTAGTGCCAAGTACCGGGGTGCCTTCTGTGAGGCAAAAATCAAGACCGTAAAAAGGCTGGTAAAAGTCAAGGTTACTCTGAAGCCAGATAACTCTACTCAGCTTGTCCAGGATGACCAAGTGAAAGGACCTTTAAGAGTTGGTGCAACAGTTGAAATGAAAACAACTGATGGATCCCCGCAGGAAGCCATTATTAGTAAATTGACGGATGCAAGCTGGTATACAGTAGTTTTTGATGATGGTGATGAAAAGACATTACGGAGAACATCATTGTGTTTAAAGGGGAGAGGCATTTTGCAGAAAGTGAGACTCTGGACCAACTTCCACTCACTAATCCTGAACATTTTGGACTCCAGTAATTGGTAAAAAACCCACAGGGGAAGAGATCGTCTCTTCCATGACTGAGATGAAAAAAGAGAGCAGTGAAGAGAGATGAAGATTAAGCGCTTATGATGACTATTGGCAAATATCATTGGAAATGCATCATCTAAGATGTTACGCACTGTGTTCTCCACTGTATGAGACCTGCGTAAAAGACATGTTTGTCCTCGTGGTGACCAAGTT
  5   1   2       bld Neu7 5g3  in                         XL017e01.5p                     AGGCTTATTGTTGTAGTGAAGACAAATCTTCGAGCTGGAATCCCTCAAATAACCTTTGACGATGAAGGCAGTGGATGAGCCTGCCTACCTAACAGTGGGGACTGATGTTAGTGCCAAGTACCGGGGGGCCTTCTGTGAGGCAAAAATCAAGACCGTAAAAAGGCTGGTAAAAGTCAAGGTTACTCTGAAGCCAGATAACTCTACTCAGCTTGTCCAGGATGACCAAGTGAAAGGACCTTTAAGAGTTGGTGCAACAGTTGAAATGAAAACAACTGATGGATCCCCGCAGGAAGCCATTATTAGTAAATTGACGGATGCAAGCTGGTATACAGTAGTTTTTGATGATGGTGATGAAAAGACATTACGGAGAACATCATTGTGTTTAAAAGGGGAGAGGCATTTTGCAGAAAGTGAGACTCTGGACCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAGTAATTGGTAAAAAAACCAACAGGGGAAGGAGATCGTCTCTTCCAATGACTGAAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTT
  5   1   2       bld Ga12      in                         XL200l20.5p                                                                                                                                             CGAGGGGGCCTTCTGTGAGGCAAAAATCAAGACCGTAAAAAGGCTGGTAAAAGTCAAGGTTACTCTGAAGCCAGATAACTCTACTCAGCTTGTCCAGGATGACCAAGTGAAAGGACCTTTAAGAGTTGGTGCAACAGTTGAAATGAAAACAACTGATGGATCCCCGCAGGAAGCTATTATTAGTAAATTGACAGATGCAAGCTGGTATACAGTAGTTTTTGATGATGGTGATGAAAAGACATTACGGAGAACATCATTGTGTTTAAAAGGGGAGAGGCATTTTGCAGAAAGTGAGACTCTGGACCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAGTAATTGGTAAAAAAACCAACAGGGGAAGGAGATCGTCTCTTCCAATGACTGAAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTTAAAGCGCCTTAATGATGAACTATTGGGCAAAATAGTCAGTGTGAAATGCAGTCCATCTAAAGAATGGTTTACAGCACTGGTTGTATCTCCAAGCTGTAGTGATGACACTGCTGTAAAAAAGGACCAGTGTTTGGTTCGCTCGTTGGTTGACTCAAAGTTTCATTCAGTTGCAAGGAAAGATCTTACTGAACTTTGATGTCGATGTCTTAAA
  3   1   2       bld Neu7 5g3  in                         XL017e01.3p                                                                                                                                                                                                                                       GTCCAGGATGACCAAGTGAAAGGACCTTTAAGAGTTGGTGCAACAGTTGAAATGAAAACAACTGATGGATCCCCGCAGGAAGCCATTATTAGTAAATTGACGGATGCAAGCTGGTATACAGTAGTTTTTGATGATGGTGATGAAAAGACATTACGGAGAACATCATTGTGTTTAAAAGGGGAGAGGCATTTTGCAGAAAGTGAGACTCTGGACCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAAGTAATTGGTAAAAAAACCAACAGGGGAAGGAGATCGTCTCTTCCAATGACTGAAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTTAAAGCGCCTTAATGATGAACTATTGGGCAAAATAGTCAGTGTGAAATGCAGTCCATCTAAAGAATGGTTTACAGCACAGGTTGTATCTCCAAGCTGTAGTGATGACACTGCTGTAAAAAAGGACCAGTGTTTGGTTCGCTCGTTGGTTGACTCAAAGTTTCATTCAGTTGCAAGGAAAGATCTTACTGAACTTGATGTCGATGTCTTAAAGTCGGAGCATTGTGGAAAGCAAGGTGTACAGGACGCCATTGCCTTTCTGACATCCAGGATAATCCCTGAGAAATGGAAAATGGACATGAGTGAAATCCTTAATCTTCCAGCAGCGATAAGAAGCGGAGAGGAGGAGCTAGCGACAG
  3   1   2       bld Ga18      in                      xlk106a10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                        CATCATTGTGTTNAAAAGGGNAGAGGCATTTTGCAGAAAGTGAGNCTCTGGNCCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAGTAATTGGTAAAAAANCCAACAGGGGAAGGAGATCNTCTCTTCCAATGACTGNAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTTAAAGCGCCTTAATGATGAACTATTGGGCAAAATAGTCAGTGTGAAGTGCAGTTCATCTAAGGAATGGTTTACAGCACTGGTTGTATCTCCAAGCTGTAGTGATGACACTGCTGTAAAAAAGGACCAGTGTTTGGTTCGCTCGTTGGTTGACTCAAAGTTTCATTCAGTTGCAAGGAAAGATCTTACTGAACTTGATGTCGATGTCTTAAAGTCGGAGCATTGTGGAAAGCAAGGTGTACAGGACGCCATTGCCTTTCTGACATCCAGGATAATCCCTGAGAAATGGAAAATGGACATGAGTGAAATCCTTGAATCTTCCAGCAGCGATGAAGAAGCTGGAGAGGAGGATGCTAGCGACAGTGATCAGAACAAAGAAGAAGAGGAAGAAACTCAGCTTGAAGAGGAGGCAGATCCAGCAGAGAGAGACAACTTCCTTCAGCAGCTCTACAAGTTTATGGAAGACAGAGGTAAAGTTATAACGCGAATGATTTAAATACATCGAGTCAAGTGTAAATGACAGTGAGCACAACTTCACACGAGTCCTGTTTCTATTAGTAACATTGGTAAAACAGCTGNATTAAAGACACAACATCATCATGGAATNCCATAAAAGCGTTGANATA
  3   1   2      seed Te2  5g3  in                    IMAGE:7391567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTGAGACTCTGGACCAACTTCCACTCACTAATCCTGAACATTTTGGAACTCCAGTAATTGGTAAAAAAACCAACAGGGGAAGGAGATCGTCTCTTCCAATGACTGAAGATGAAAAAGAGGAGAGCAGTGAAGAAGAAGATGAAGATTTAAAGCGCCTTAATGATGAACTATTGGGCAAAATAGTCAGTGTGAAATGCAGTCCATCTAAAGAATGGTTTACAGCACTGGTTGTATCTCCAAGCTGTAGTGATGACACTGCTGTAAAAAAGGACCAGTGTTTGGTTCGCTCGTTGGTTGACTCAAAGTTTCATTCAGTTGCAAGGAAAGATCTTACTGAACTTGATGTCGATGTCTTAAAGTCGGAGCATTGTGGAAAGCAAGGTGTACAGGACGCCATTGCCTTTCTGACATCCAGGATAATCCCTGAGAAATGGAAAATGGACATGAGTGAAATCCTTGAATCTTCCAGCAGCGATGAAGAAGCTGGAGAGGAGGATGCTAGCGACAGTGATCAGAACAAAGAAGAAGAGGAAGCAACTCAGCTTGAAGAGGAGGCAGATCCAGCAGAGAGAGACAACTTCCTTCAGCAGCTCTACAAGTTTATGGAAGACAGAGGTAAAGTTATAACGCGAATGATTTAAATACATCGAGTCAAGTGTAAATGACAGTGAGCACAACTTCACACGAGTCTTGTTTCTATTAGTAACATTGGTAAAACAGCTGCATTAAAGACGCAACATCATCATGGAATGCCATAAAGCGTTGATTATAAGTCTTAATGACCC
  3   1   2       bld Ga12      in                         XL200l20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAATAGTCAGTGTGAAAATGCAGTCCATNTAAAGAATGGTTTACAGCACTGGTTGTATCTCCAAGCTGTAGTGATGACACTGCTGTAAAAAAGGACCAGTGTTTGGTTCGCTCGTTGGTTGACTCAAAGTTTCATTCAGTTGCAAGGAAAGATCTTACTGAACTTGATGTCGATGTCTTAAAGTCGGAGCATTGTGGAAAGCAAGGTGTACAGGACGCCATTGCCTTTCTGACATCCAGGATAATCCCTGAGAAATGGAAAATGGACATGAGTGAAATCCTTGAATCTTCCAGCAGCGATGAAGAAGCTGGAGAGGAGGATGCTAGCGACAGTGATCAGAACAAAGAAGAAGAGGAAGAAACTCAGAGTAAATCGTTTTTAAAAATCTGGATTATTTGGATAAAATGGAGTCTATGGGAGATGGCCTTTCCGTAATTTGGAATTTTTTGGATAAGGGGATTCCGGATAACGGATGCCATAACTGAATGTTACTTCTATACTATTTGTTCCCAAATATTTTGACATTACACAGTTGGTGTATGATGTACATTGTTTTGCTTCCTTGTTGGAATATATTTTCCAACAATATCATTAGGGTTACGCTTATGTTCAAATAAACTCAAACATTATATTCTGAAATCAAAGTTGTTATTTTGCTGTAGCCTTTAGCTGATTCCAAAACTGGTTTATTTGGCTCACATTTTGCTTTGTGCATCTTTATTCTGCTAATAAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)