Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL158i03.5                            7 END     1          10       14                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8820649.3                       6 END     1          10       16                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012784441 Xl3.1-XL432b19ex.5 - 10 ESTs
                                                                       .........-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL432b19ex.5                                                                      GTAATTGTCGGGCCCTCGCGCCTCTGATTTCTTGTCCTGCCCATGATCAGCCTGAGATAGGGAGCTCCATGTAGGGGACTGGGCAGAGGGAAAACCCCGATCCCATCGCTGTTTCTTCTTTGCTGCTTTTTGCTTCTGCCCCCCGCCTTCTGCTGCTGCTGCACCCCGGGATCTGCTATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGAACCCCACAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGTGACCTCCCTGTGCCATGGCAGGATAAGAGCACTGATCGTCTTATACTGGGGCCAGGGCTTGTCCCTAATTGCTGCACAGTTGGATCCATGTGGCCTCTGAATGGAATTGT------------AATTTCCACGTATGGCTCCGCCAAGTCGCTCAGTAC
                                                  Xl3.1-CHK-1012696243                                                                            GTCGGGCCCTCGCGCCTCTGATTTCTTGTCCTGCCCATGATCAGCCTGAGATAGGGAGCTCCATGTAGGGGACTGGGCAGAGGGAAAACCCCGATCCCATCGCTGTTTCTTCTTTGCTGCTTTTTGCTTCTGCCCCCCGCCTTCTGCTGCTGCTGCACCCCGGGATCTGCTATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGAACCCCACAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGTGACCTCCCTGTGCCxxGxCxGGATAAGAGCACTGATCGTCTTATACTGGGGCCAGGGCTTGTCCCTAATTGCTGCACAGTTGGATCCATGTGGCCTCTGAATGGAATTGTGTCCCGAAATGGAATTTCCACGTATGGCTCCGCCAAGTCGCT
                                                      consensus depths                                                                           3     3     3     4     3     5     5     5     5     5     6     7     6     8     7     8     7     8     7     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     8     8     7     8     7     8     7     8     7     8     5     8     5     8     5     8     3     8     4     8     3     8     3     8     3     9     3     9     3     8     3     8     2     8     2     8     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     0     6     2     7     2     7     2     6
                                                    Xl3.1-XL432b19ex.5                                                                                              TGA---------------ATG------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TGA---------------------TAA------TGA------------------------------TAA
  5   1   0       add Ga12      out                        XL161c13.5p CCTGAGATAGTGACACTCATGTAGGGACTGGGCACAGGGGACCCCTGATCTCATCGCTATTTCTGCTTGTGTCCCCCCTGCCCTCTGCTGCACCCCTGGATCCATACACGATCTGCAACAAGCTCTGCTGCACTTCTCATTCTGCATCAAGCACAGGACTctgcactctctgctctgcacccaacatctgactctgctctgcacccaacatctgcctctgcATCCAAGATCTGACTCTGCACCCAACATCTGACTCTCTGCTCTGCACCCAACATCTGGTTCTCTGCACCCAACATCTGCCTCTGCACCCAAGATCTGACTCTCTGCTCTGCACCCAAGATCTGACTCTGCTCTGCACCCAACATCTGCCTATCTGCTCTCCACCCGGGATATACAAAGGCCCCAAAGCTTTGCTCCGCACTTTTTGTCTCTGCCCCCCATTTGCACTGCTACTTCCTAGGCCAGACCCCAGCACCGACCCACCATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGTCAAGTCCCTGTGG
  5   1   2       bld Thy                             IMAGE:8547635.5p                      TTTCTTTTTTAACAGAAGTACAAACGAAAAAGAATTCGTCCCGGAGAAGTAATTGTCGGGCCCTCGCGCCTCTGATTTCTTTTCCTGCCCATGATCAGCCTGAGATAGGGAGCTCCATGTAGGGGACTGGGCAGAGGGAAAACCCCGATCCCATCGCTGTttcttctttgctgctttttgcttctgccccctgccttctgctgctgctgcACCCCGGGATCTGCTATCCGCTCTGCACCCCACAATCCGCTCTGCACCCCTCAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGCACCCCTCAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGACAAGAGCAAGCGAGAGATGTACAACCGCCTGAAGAACCAGTAGAGGGCAAAGATGGCAGGATAAGAGCACTGATCGTCTTATACTGGGGCCAGGGCTTGTCCCTAATTGCTGCACAGTTGGATCCATGTGGCCTCTGAATGGAATTGTGTCCCGAAATGGAATTTCCACGTATGGCTCCGCCAAGTCGCTCAGTACAGAGAGACGGGTTCAGGAGAACGTGGCTTTTCAGCTCACTGCACAGAGAAGCTGCTTCTCATTGAAGGAGAATCGTTTGTGAAAGTAAAAGTTGCCATT
  5   1   2       bld Emb1 5x3                        IMAGE:6636145.5p                                                     CCACGCGTCCGGGAGAAGTAATTGTCGGGCCCTCGCGCCTCTGATTTCTTGTCCTGCCCATGATCAGCCTGAGATAGGGAGCTCCATGTAGGGGACTGGGCAGAGGGAAAACCCCGATCCCATCGCTGtttcttctttgctgctttttgcttctgccccccgccttctgctgctgctgcACCCCGGGATCTGCTATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGCACCCCTCAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGCACCCCTCAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGTGACCTCCCTGTGCCCAGACCCACCCGCCTGCCAGGCTTGCCCTGTGCCATTGTGGCTACCAGGGGGCTACTGTGCCAAGAATCTGGGGTCTTGTCCCCTGTCACCAGCCTGGCTTTCACCATGAACAAACTGGCCGGCCTGGGAAGCCAAAATGAGACACCAAAAAGAAAACTTGGCATTTTCCTTCCAGCCTCAGTGCACCTCCCTGTTGCGCACGTCATCTTCTGATTCGTCCCGATTCCGGTCTCTGCCTTGGATTTcccccagccccccAGGAATTGGAAGGTCACCCCACAAAACGTTTGG
  5   1   2       bld Emb1                            IMAGE:6635699.5p                                                                GGAGAAGTAATTGTCGGGCCCTCGCGCCTCTGATTTCTTGTCCTGCCCATGATCAGCCTGAGATAGGGAGCTCCATGTAGGGGACTGGGCAGACGGAAAACCCCGATCCCATCGCTGTTTCTTCTTTGCTGCTTTTTGCTTCTGCCCCCCGCCTTCTGCTGCTGCTGCACCCCGGGATCTGCTATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCCGCTCAGCATCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGCACCCCTCAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCCCCCTACAATCCGCCTCTGCACCCCTCAATCCGCTCAACTTCAAGGCCTGAAGATTCATGCACCTCATTATCCCCCCTGCAGCAACGCCTGACACCTTGCACTCCCCGCCTCTGCTCCCCCACGGATCTACAAAACGCCGCAAGAGCTCTGGCCCTTTCTTGCCCCCTTGCCCCCCTATTCGGAAGTTGCCGGGATTCCCCACGGGCCGCGAGCCCCCCCTTTCATCGGGAGTCCGCGCCCAAGGGTGGCCCGAAATGACTCTCCAGCGCCCCTGCCTCCGGAAAGGGACCCGGGCACCGGGGGCCCTAATATACATCCCCAGGTCTCGCTACCACAGAATTAGAACCCCTGCGCACCTCTCTGACCCTGTCAACACCATGAGGGGGGCCCCCCCAGGGTGGCTCTAATCGCAATGCGTCGTGTGCGAATCTTATCGGCCCGCGCCCCGTTGCCGCACCCCCACCCCGCGCTATGGCGGCCTTCTACTCCCCGCGAGCGCGACAAAGTGAGAGTCAATGTGGGTGCGACGGAGTGACGTTGTGGATCTGAATACTGCACCCACCAAGAATGTGTGAGGACCTTCGGCCGCCACACGCGCAGGGCAAAACAAGCTAGTGGGAGGGTCGCGTTTGTAGTCGCGCTGCTCGCAATGCACTACTGCGGATGGCGCGGCAATCCCCCAGTGTCATCGCGATGGCNATTGCCGTACTACAAATATTCCACGACAGTCTCCTATTTGTCTATATAATTATCGACGCCCTCGCCGTGAATCAAGACACATGGGGAGCTGTATGACACGTACTCTCGATGTGAGAACATCCCCTCCCTCATGGCTTTGGCCCGACTTCTCCTCTTCACTTGTGTCTCCGCCGGCGCTGCTCATCCCACATCCCGCGGGAGGATGGTNTGACGGAGTTTTAGTCGTTGGTGTAAACAATTACTCTCTTCATTGGGGCGCTATCTTCAAGTGCAGTACCCGGCTAAACACTGTCGAACACGTTACATATTCAGAACATCGATACCATGATCGTAATGAACTAGTTGGCAACGTGTTTTCCTCACCACGCGCTTGCCGACCCGACA
  5   1   2      seed Ga12                                 XL141g22.5p                                                                              GGGCCCTCGCGCCTCTGATTTCTTTTCCCTGCCCATGATCAGCCTGAGATAGGGAGCTCCATGTAGGGGACTGGGCAGAGGGAAAACCCCGATCCCATcgctgtttcttctttgctgctttttgcttctgccccccgccttctgctgctgctgcACCCCGGGATCTGCTATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGAACCCCACAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGTGACCTCCCTGTGCCCAGACCCA
  5   1   2       bld Gas9                                 BG409602.5p                                                                                             TGATTTCTTTTCCCTGCCCATGATCAGCCTGAGATAGGGAGCTCCATGTAGGGGACTGGGCAGAGGGAAAACCCCGATCCCATCGCTGTTTCTTCTttgctgctttttgcttctgccccccgccttctgctgctgctgcaccccgggatctgctATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGCACCCCTCAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCAGGAGTGACCTCCCTGTGCCCAGACCCACCCGCCTGCCAGGCTTGCCCTGTGCCATTGTGGCTACCAGGGGGCTACTGTGCCAAGAATCTGGGGTCTTGTCCCCTGTCACCAGCCTGGCTTTNCCATGAACAAACTGGCCGGCCTGGGAAAGCCAAAA
  5   1   2       bld Ga15      out                      XL432b19ex.5p                                                                                                                               GGGAGCTCCATNGTAGGGGACTNGGGCAGAGGGAAAACCCCGATCCCATCGCTGTTTCTTCTTTgctgctttttgcttctgccccccgccttctgctgctgctgcaccccgggatctgctATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGAACCCCACAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGTGACCTCCCTGTGCCCAGACCCACCCGCCTGCCAGGCTTGCCCTGTGCCATTGTGGCTACCAGGGGGCTACTGTGCCAAGAATCAGGGGTCTTGTCCCCTGTCACCAGCCTGGCTTTCACCATGAACAAACTGGCCGGCCTGGGAAGCCAAAATGAGACACCAAAAAGAAAACTTGGCATTTCCTTCCAGGCTCAG
  5   1   2       bld Ga12                                 XL159k17.5p                                                                                                                                 GGGAGCTCCATGTAGGGGACTGGGCAGAGGGAAAACCCCGATCCCATCGCTGTTTCTTCTTTGCTGCTTTTTGCTTCTGNCCCCCGCCTTTTGCTGCTGCTGCACCCCGGGATCTGCTATCCGCTTTGCACCCCACAATCCGCTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGNAGCAAGCCTGAAGACTCTGCACCCCACAATNTCGCTCAGNAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGCACCCCTCAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCAC
  5   1   2      shim Ga15                               XL464c12ex.5p                                                                                                                                        TGTGTGATCTTCTTTGCTGNTTNNTGNTTCTGCCCCCCGAACTTCTGCTGNTGCTGCACCCCGGGATCNGNTATNCGCTTTGCACCCCACAATNNGCTCTGCACCCCACAATCCGNTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCAGCAGCAAGCCTGAAGACTCTGCACCCCACAATCCGCTCTGAACCCCACAATCCGCTCTGCAGCAAGCCTGAAGACTCTGCACTCTCTGCTCTGCGCCCCAGGATCTACAAAGGCCCAAAGCTCTGCACTTTTGTCTCTGCCCCCCATTTGCACTGCTGTTTCCCAGGCCAGAGCCTCACACAATGGAGTTGGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGTGACCTCCCTGTGCCCAGACCCACCCGCCTGCCAGGCTTGCCCTGTGCCATTGTGGCTACCAGGGGGCTACTGTGCCAAGAATCAGGGGTCTTGTCCCCTGTCACCAGCCTGGCTTTCACCATGAACAAACTGGCCGGCCTGGGAAGCCAAAATGAGACACCAAAAAGAAAACTTGGCATTTCCTTCC
  5   1   0       add Tbd7                                 XL110d08.5p                                                                                                                                                                                                                                                                                                                                                                                                                  GATTTCTTTCCCACCTTTCAGTCCCATTGTGAGCCTCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAGCACCTGAAGATGTTCCGTTCCAAGAGTCGGACCTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAACCGCCTGAAGAACCAGTAGAGGGCANTANATGGCAGGATAAGAGCACTGATCGTCTTATACTGGGGCCAGGGCTTGTCCCTAATTGCTGCACAGTTGGATCCATGTGGCCTCTGAATGGAATTGTGTCCGGAAATGGAATTTCCACGTATGGCTCCGCCAAGTCGCTCAGTACAGGAGAGACG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)