Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6868774.5                      10 END     1          12       10                MGC80273 protein [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:3402754-IMAGp.5                 4 END     1          12       25                x-Delta-1
     3   2.0    0Xl3.1-IMAGE:6631563.5                       3 END     1          12       33                delta-like 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012784493 Xl3.1-xlk163l06ex.3 - 8 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk163l06ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCTGTTTGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTGAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGTCCAAGACAATGAATAACCTGGCCAACTGTCAAAGAGAAAAAGACATTTCTGTAAGCTTCATAGGCACAACTCAGATCAAAAACACAAACAAGAAAATAGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGATTCACCTAAAGAAGAGCGTAGCAAATGTGAAGCTAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCAACGTCAAAAGACACAAAATATCAGTCAGTTTATGTCATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGATGCTGTACAGCACAAGGTTCTTGTCAGTTATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTTAATTCAGGCTGAGCTGGTTCTCTCCTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTAAATTATTATAATAAATATATATATATATATATAAATATATATATATTTAATGAATGGACTTCAATGTATGTCAGAAGAAGGGTGACCTGACTGAGGTGTAAATTTTGGATTTGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACCAGGTCAAAAAATGTGTATTTTTTGAACTTATGAAACTATTTTTACGATATTTGTAAAGCTCAAGTATTTGTGATGTTCATTTTTATATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATTGTATTTGATTTTTTTCTACTGTTTTTTTTTTGTTAATGAAG
                                                  Xl3.1-CHK-1012698832                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCTGTTTGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTGAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGTCCAAGACAATGAATAACCTGGCCAACTGTCAAAGAGAAAAAGACATTTCTGTAAGCTTCATAGGCACAACTCAGATCAAAAACACAAACAAGAAAATAGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGATTCATCTAAAGAAGAGCGTAGCAAATGTGAAGCTAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCAACGTCAAAAGACACAAAATATCAGTCAGTTTATGTCATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGATGCTGTACAGCACAAGGTTCTTGTCAGTTATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTTAATTCAGGCTGAGCTGGTTCTCTCCTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTAAATTATTATAATAAATATATATATATATATATAAATATATATATATTTAATGAATGGACTTCAATGTATGTCAGAAGAAGGGTGACCTGACTGAGGTGTAAATTTTGGATTTGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACCAGGTCAAAAAATGTGTATTTTTTGAACTTATGAAACTATTTTTACGATATTTGTAAAGCTCAAGTATTTGTGATGTTCATTTTTATATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATTGTATTTGATTTTTTTCTACTGTTTTTTTTTTGTTAATGAAGGAAGCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     3     4     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     5     2     5     3     5     3     5     3     5     3     5     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     3     5     3     5
                                                                       ...PREDICTED - Cf ---- 1e-012     XP_858084.1 PREDICTED: similar to Delta-like protein 4 precursor (Drosophila Delta homolog 4) isoform 3 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-050     NP_571030.2 deltaD [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PREDICTED - Bt ---- 2e-054     XP_869452.2 PREDICTED: similar to delta-like 1 (Drosophila) isoform 2, partial [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-061     NP_031891.2 delta-like 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-066     NP_005609.3 delta-like 1 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-082     NP_990304.1 C-Delta-1 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-103     NP_001093689.1 delta-like 1 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 6e-105     AAC38017.1 x-Delta-1 [Xenopus laevis]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk163l06ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TGA------TAA------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------TAA---------------ATG---------------ATG------------TGA------TGA---------------------TGA---------------------------------------ATG---------------TAA---------------------------------------------TGA---------------------------------------ATG------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   1       add Em10                            IMAGE:7980001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAGAAATAATCGATATGTGTGTCAATGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTCTTGCTTCCTGAAGAGAAACCTGTTGTTGTCGACTTGACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCTGTTTGTGCTGGGAttgtcttggtgctgatgttgctgctgggctgtgctgctgtggttgtctgtgtgAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGTCCAAGACAATGAATAACCTGGCCAACTGTCAAAGAGAAAAAGACATTTCTGTAAGCTTCATAGGCACAACTCAGATCAAAAACACAAACAAGAAAATAGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGATTCACCTAAAGAAGAGCGTAGCAAATGTGAAGCTAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCAACGTCAAAAGACACAAAATATCAGTCAGTTTATGTCATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAAGTGTAATACGGATGCTGTACAGCACAAGGTTCTTGTCAGTTATCAAAGCTGACGCCATGTGATGCTGCTGGTGAAAGAGTCAGGGAATCCCTTTGTGACTGCTGCTGAACACTAATCNGCTGAGCTGTCCTACTGAATAGGAAATAAGACGCAA
  5   1   2      skin FaBN                            IMAGE:8079136.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTGACTGAAAAATACACAGAAGGGCAAAACGGACAATTCCCATGGATTGCTGTTTGTGCTGGGATCATcttggtgctgatgctgcttctgggctgtgctgctgtggttgtgtgtgtgAGGGTTAGAGTGCAGAAGAGACGCCATCAACCTGAGGCCTGCCGTGGTGAAAACAAGACAATGAATAACCTGGCCAACTGTCAAAGAGAAAAGGACATTTCTGTAAGCATCATAGGCACCGCACAGATCAAAAACACAAATAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCATGAACTGAAGAATGAGGACTCATCTAAAGAAGAGCGTAGCAAATGTGAAGCAAAGTGCAGCTCAAACGACTCAGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCTTCAGAAAGAAGACGACCAGACTCTGCCTACTCAACGTCAAAAGACACAAAATATCAGTCGGTTTATGTCATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCGGTTATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTTAATTCAGGCTGAGCTGGTTCTCTCCTGAAATTAGGGGAAATAAAAAG
  5   1   2       add Egg1                               PBX0161A11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAATGTGAAGCTAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCAACGTCAAAAGACACAAAATATCAGTCAGTTTATGTCATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGATGCTGTACAGCACAAGGTTCTTGTCAGTTATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATTAAAAGACTGCAAAACAATATGGACACCGCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCTGTACTTCTCCATTGCACTATAGACAGATGCTTTTTTTAAATTATTATAATATATA
  3   1   2       bld Ga18 5g3  out                     xlk163l06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AANCNCAGNANNCTNAAANNNNNNTTCNTCNGAAAGNNNNNGNCCAGNCTCTNNNTACTCAACGTCAAAAGACNNAAAATNTCAGTCGNTTTATGTCATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGNCGCTGTACAGCACAAGNTTCTTGTCGGTTATTCAANCNNNNGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTTAATTCAGGCTGAGCTGGTTCTCTCCTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGNNCTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTAAATTATTATAATAAATATATATATATATATATAAATATATATATATTTAATGAATGGACTTCAATGTATGTCAGAAGAAGGGTGACCTGACTGAGGTGTAAATTTTGGATTTGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACCAGGTCAAAAAATGTGTATTTTTTGAACTTATGAAACTATTTTTACGATATTTGTAAAGCTCAAGTATTTGTGATGTTCATTTTTATATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATTGTATTTGATTTTTTTCTACTGTTTTTTTTTTGTTAANGAAGGAAGTAATT
  5   1   2       bld Ga18      in                       xlk68e09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTTAATTCAGGCTGAGCTGGTTCTCTCCTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTAAATtattataataaatatatatatatatatataaatatatatatatTTAATGAATGGACTTCAATGTATGTCAGAAGAAGGGTGACCTGACTGAGGTGTAAATTTTGGATTTGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACCAGGTCAAAAAATGTGTATTTTTTGAACTTATGAAACTATTTTTACGATATTTGTAAAGCTCAAGTATTTGTGATGTTCATTTTTATATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACtatattttttgtatatatatgtatttatggaatattgtgcaaattgtatttgattttttttctactgttttttttttGTTAATGAAGGAAGNAANTTTTTAAACTATTTTTCCAAAATAAATACTATAAATGATaaaaaaaaaa
  3   1   2      seed Ga18      in                       xlk68e09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTTAATTCAGGCTGAGCTGGTTCTCTCCTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGNNCTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTAAATTATTATAATAAATATATATATATATATATAAATATATATATATTTAATGAATGGACTTCAATGTATGTCAGAAGAAGGGTGACCTGACTGAGGTGTAAATTTTGGATTTGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACCAGGTCAAAAAATGTGTATTTTTTGAACTTATGAAACTATTTTTACGATATTTGTAAAGCTCAAGTATTTGTGATGTTCATTTTTATATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATTGTATTTGATTTTTTTCTACTGTTTTTTTTTTGTTAATGAAGGAAGTAATTTNTAAAC
  3   1   2       bld Sp1  5g3  out                   IMAGE:4964253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTAAATTATTATAATAAATATATATATATATATAAATATATATATATTTAATGAATGGACTTCAATGTATGTCAGAAGAAGGGTGACCTGACTGAGGTGTAAATTTTGGATTTGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACCAGGTCAAAAAATGTGTATTTTTTGAACTTATGAAACTATTTTTACGATATTTGTAAAGCTCAAGTATTTGTGATGTTCATTTTTATATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATTGTATTTGATTTTTTTCTACTGTTTTTTTTTTGTTAATGAAGGAAGCAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATGATA
  3   1   2       bld Emb1      out                   IMAGE:3402754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCATGTTATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTCAAGTATTTGTGATGTTCATTTTTATATAATTTAAACTTTGTTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATATTTTTTTTGTATATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTCTACTGTTTTTTTTTTGTTAATGAAGGAAGGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAATAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)