Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 56%

 1012784510 Xl3.1-IMAGE:4030640.5 - 5 ESTs
                                                                       ....-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4030640.5                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGGATCTGTGTCACGGACGCACCTGAGAGGAGGCAGCTGTCAGAGAGAGAAATCACCATGTCTTCAGATGATTTTGTACCTCAGAAGGGGGACAGTACGTCCTCAAAACTGCTCAAGAAGACCAAGGAGTCTCCCTTTGTCCCAATAGGAATGGCTGGCTTTCTGGGTGTGGTGGCCTATGGCCTGTACAGAATTCGCAGCAGAGGGCAGCAGAAGATGTCTGTGCACATTATTCACACCAGGGTGGCTGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTCCTATATTCCATGTATAAAGAATACATCAAGCCACGTTTCAGTGATGACTAAGAGTCTCCTCCAGTGGAATGTCCACAACTTGCTCCCTACATCAGACCTTTATATTTGGGAGTTGCTAGACACTCGTGCCACAATAAGGAATTGCACTGTAACTAGTAGTGATGCACCCAATCCTGACTTCTCTCTTACACTTAAGCCCCATTTGCAGCATTTAGGTCAGTCTGAATCCTTATAGTTTGGCTGAATCCAAACCCTTTACCTGTGTGACTTCAAAGAAGTTGTTCAGTGTACAAACAGAATATTTGTTTATAGAATGGTGTGATTTTGCGCAAACACCAAAATGCAGTTTAGGGTTTGGGTTCAGTTTAATATTTGGCCAAATCTTTTGTGAAACATTCAGTAAACATGAACCTGTGGATTCTGTGCACTCCTATAAGATAGTAATCGAAGTCAGAAGAGCACATCTCCCAG
                                                  Xl3.1-CHK-1012704129                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCCGGATCTGTGTCACGGACGCACCTGAGAGGAGGCAGCTGTCAGAGAGAGAAATCACCATGTCTTCAGATGATTTTGTACCTCAGAAGGGGGACAGTACGTCCTCAAAACTGCTCAAGAAGACCAAGGAGTCTCCCTTTGTCCCAATAGGAATGGCTGGCTTTCTGGGTGTGGTGGCCTATGGCCTGTACAGAATTCGCAGCAGAGGGCAGCAGAAGATGTCTGTGCACATTATTCACACCAGGGTGGCTGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTCCTATATTCCATGTATAAAGAATACATCAAGCCACGTTTCAGTGATGACTAAGAGTCTCCTCCAGTGGAATGTCCACAACTTGCTCCCTACATCAGACCTTTATATTTGGGAGTTGCTAGACACTCGTGCCACAATAAGGAATTGCACTGTAACTAGTAGTGATGCACCCAATCCTGACTTCTCTCTTACACTTAAGCCCCATTTGCAGCATTTAGGTCAGTCTGAATCCTTATAGTTTGGCTGAATCCAAACCCTTTACCTGTGTGACTTCAAAGAAGTTGTTCAGTGTACAAACAGAATATTTGTTTATAGAATGGTGTGATTTTGCGCAAACACCAAAATGCAGTTTAGGGTTTGGGTTCAGTTTAATATTTGGCCAAATCTTTTGTGAAACATTCAGTAAACATGAACCTGTGGATTCTGTGCACTCCTATAAGATAGTAATCGxxxxxAxxxxAxCACATCTCCCAGATTTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     2     3     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     2     5     2     5     2     5     2     5
                                               BLH ATG      66      94                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN      39      34                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 6e-011     XP_001177257.1 PREDICTED: similar to ENSANGP00000018553 [Strongylocentrotus purpuratus] ===============================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dm ==== 2e-014     NP_731561.1 CG17734-PB, isoform B [Drosophila melanogaster] =======================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ag ==== 3e-015     XP_311428.3 AGAP010716-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---= 9e-025     NP_956394.1 Unknown (protein for MGC:77692) [Danio rerio] ==========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 7e-025     XP_001231200.1 PREDICTED: hypothetical protein [Gallus gallus] =========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Cf ==== 2e-025     XP_861494.1 PREDICTED: similar to hypoxia induced gene 1 isoform 2 [Canis familiaris] ==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Bt ==== 8e-026     XP_001249479.1 PREDICTED: hypothetical protein [Bos taurus] ============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 2e-026     NP_001103089.1 HIG1 domain family, member 1C [Homo sapiens] ===================================================================================================================================================================================
                                                                       PROTEIN --- Mm ---- 3e-029     NP_001019843.1 UbiE-YGHL1 fusion protein [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 1e-043     CAJ81782.1 hypoxia induced gene 1b [Xenopus tropicalis] ================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xl ==== 1e-047     NP_001084777.1 hypothetical protein LOC431813 [Xenopus laevis] =========================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4030640.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------ATG---------------------ATG------------------------------------TAA------------------------------------------------------------------------------------------------------TAGTAGTGA------------TGA---------------TAA---------------------------TGA---------------------------------------TGA------------------------------------------TAG------------------------------------TAG---------------TAA------------------------------------ATG------------------------------TAGTAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                ]
  5   1   2       bld Kid  5x3                        IMAGE:4030640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGGATCTGTGTCACGGACGCACCTGAGAGGAGGCAGCTGTCAGAGAGAGAAATCACCATGTCTTCAGATGATTTTGTACCTCAGAAGGGGGACAGTACGTCCTCAAAACTGCTCAAGAAGACCAAGGAGTCTCCCTTTGTCCCAATAGGAATGGCTGGCTTTCTGGGTGTGGTGGCCTATGGCCTGTACAGAATTCGCAGCAGAGGGCAGCAGAAGATGTCTGTGCACATCATTCACACCAGGGTGGCTGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTCCTATATTCCATGTATAAAGAATACATCAAGCCACGTTTCAGTGATGACTAAGAGTCTCCTCCAGTGGAATGTCCACAACTTGCTCCCTACATCAGACCTTTATATTTGGGAGTTGCTAGACACTCGTGCCACAATAAGGAATTGCACTGTAACTAGTAGTGATGCACCCAATCCTGACTTCTCTCTTACACTTAAGCCCCATTTGCAGCATTTAGGTCAGTCTGAATCCTTATAGTTTGGCTGAATCCAAACCCTTTACCTGTGTGACTTCAAAGAAGTTGTTCAGTGTACAAACAGAATATTTGTTTATAGAATGGTGTGATTTTGCGCAAACACCAAAATGCAGTTTAGGGTTTGGGTTCAGTTTAATATTTGGCCAAATCTTTTGTGAAACATTCAGTAAACATGAACCTGTGGATTCTGTGCACTCCTATAAGATAGTAATCGTGTGTATTTAACCACATCTCCCAGATTTCTAGAACGAATTGTAATGCTCACAAATAACTCCCAACCCCATCCC
  5   1   2       bld Kid  5x3                        IMAGE:4030641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGGATCTGTGTCACGGACGCACCTGAGAGGAGGCAGCTGTCAGAGAGAGAAATCACCATGTCTTCAGATGATTTTGTACCTCAGAAGGGGGACAGTACGTCCTCAAAACTGCTCAAGAAGACCAAGGAGTCTCCCTTTGTCCCAATAGGAATGGCTGGCTTTCTGGGTGTGGTGGCCTATGGCCTGTACAGAATTCGCAGCAGAGGGCAGCAGAAGATGTCTGTGCACATCATTCACACCAGGGTGGCTGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTCCTATATTCCATGTATAAAGAATACATCAAGCCACGTTTCAGTGATGACTAAGAGTCTCCTCCAGTGGAATGTCCACAACTTGCTCCCTACATCAGACCTTTATATTTGGGAGTTGCTAGACACTCGTGCCACAATAAGGAATTGCACTGTAACTAGTAGTGATGCACCCAATCCTGACTTCTCTCTTACACTTAAGCCCCATTTGCAGCATTTAGGTCAGTCTGAATCCTTATAGTTTGGCTGAATCCAAACCCTTTACCTGTGTGACTTCAAAGAAGTTGTTCAGTGTACAAACAGAATATTTGTTTATAGAATGGTGTGATTTTGCGCAAACACCAAAATGCAGTTTAGGGTTTGGGTTCAGTTTAATATTTGGCCAAATCTTTTGTGAAACATTCAGTAAACATGAACCTGTGGATTCTGTGCACTCCTATAAGATAGTAATCGTGTGTATTTAAACACATCTCCCAGATTTCTAAGAACGAATTGTAATGCTCACAATTAACTCCCAACCCCCATCCCCAAATAATGATCTTGAGCTGCCCT
  5   1   2       bld Eye1 5x3                        IMAGE:6959438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTGGTCCGGTCCGGATTCCCGGGATCTGAGAGGAGGCAGCTGTCAGAGAGAGAAATCACCATGTCTTCAGATGATTTTGTACCTCAGAAGGGGGACAGTACGTCCTCAAAACTGCTCAAGAAGACCAAGGAGTCTCCCTTTGTCCCAATAGGAATGGCTGGCTTTTTGGGTGTGGTGGCCTATGGCCTGTACAGAATTCGCAGCAGAGGGCAGCAGAAGATGTCTGTGCACATTATTCACACCAGGGTGGCTGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTCCTATATTCCATGTATAAAGAATACATCAAGCCACGTTTCAGTGATGACTAAGAGTCTCCTCCAGTGGAATGTCCACAACTTGCTCCCTACATCAGACCTTTATATTTGGGAGTTGCTAGACACTCGTGCCACAATAAGGAATTGCACTGTAACTGGTAGTGATGCACCCAATCCTGACTTCTCTCTTACACTTAAGCCCCATTTGTAGCATTTAGGTCAGTCTGAATCCTTATAGTTTGGCTGAATCCAAACCCTTTACCTGTGTGACTTCAAAGAAGTTGTTCAGTGTACAAACAGAATATTTGTTTATAGAATGGTGTGATTTTGCGCAAACACCAAAATGCAGTTTAGGGTTTGGGTTCAGTTTAATATTTGGCCAAATCTTTTGTGAAACATTCAGTAAACATGAACCTGGGGGATTCTGTGCACTCCTATAAGAATAGTATCCTTGTGTATTTAACCCCCATCTCCCAGATTTCCTAAGAACGAATTGGTAATGCTCACAAAAACTCCCCCAACCCCATCCCAAATAATGGATCCGGAGCTTGCCTTAAGGTAGGGGATGTGGTTTCCCATTTGAATTTTCAGTAAAAACCAATGGTCCCCACTTTAATTTAAAAACCCCTTTTTGGTACCCGG
  3   1   2       add Te2N 5g3  in                    IMAGE:7765617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGACAGTGCCTAGCTATAGGCCTAGACAGTCGTCGATTCCGATCGACCCTGAGAGAGCAGTTCGAGGAGATCACAGTCTCAGAGATTGTACTCAGAGGGGACAGTCGTCTCAAACTGTCAGAAGACCAAGAGTCTCCTTGTCCAATAGAATGCTGGCTTCTGGGTGTGTGGCTATGGCCTTACAGAATTGCAGCAGAGGGCAGCAGAAGATGTCTGTGCACATTATTCACACCAGGGTGGCTGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTCCTATATTCCATGTATAAAGAATACATCAAGCCACGTTTCAGTGATGACTAAGAGTCTCCTCCAGTGGAATGTCCACAACTTGCTCCCTACATCAGACCTTTATATTTGGGAGTTGCTAGACACTCGTGCCACAATAAGGAATTGCACTGTAACTAGTAGTGATGCACCCAATCCTGACTTCTCTCTTACACTTAAAGGAACAGTAACATCATTTTTTTTTATTAAAAAAATAAAAATTACAGCGTGTATATAATACCCATGTCCCAATAGATATTACCCATTCACCCTCCTTGTACCAGAAAAGTCCCCAGAAAATACTCCCCTCCATTGTCTGAACTGATTTTGAAAAACGGCGATATGGCGATCAATGGAAGGCGAACAATACGTACAAGCGCGCTCCCGACAGTGCTCCTTCAGCCAGGACTTCCGTCATGAAAGTAAAACCGGAAGTCAGAAGAGTTTCTGACAGGGCATGCATCCTACGACGCATAAAGTTCTCCCTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2      seed Te2N 5g3  in                    IMAGE:7765617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACGCACCTGAGAGGAGGCAGCTGTCAGAGAGAGAAATCACCATGTCTTCAGATGATTTTGTACCTCAGAAGGGGGACAGTACGTCCTCAAAACTGCTCAAGAAGACCAAGGAGTCTCCCTTTGTCCCAATAGGAATGGCTGGCTTTCTGGGTGTGGTGGCCTATGGCCTGTACAGAATTCGCAGCAGAGGGCAGCAGAAGATGTCTGTGCACATTATTCACACCAGGGTGGCTGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTCCTATATTCCATGTATAAAGAATACATCAAGCCACGTTTCAGTGATGACTAAGAGTCTCCTCCAGTGGAATGTCCACAACTTGCTCCCTACATCAGACCTTTATATTTGGGAGTTGCTAGACACTCGTGCCACAATAAGGAATTGCACTGTAACTAGTAGTGATGCACCCAATCCTGACTTCTCTCTTACACTTAAAGGAACAGTAACATCAtttttttttattaaaaaaataaaaaTTACAGCGTGTATATAATACCCATGTCCCAATAGATATTACCCATTCACCCTCCTTGTACCAGAAAAGTCCCCAGAAAATACTCCCCTCCATTGTCTGAACTGATTTTGAAAAACGGCGATATGGCGATCAATGGAAGGCGAACAATACGTACAAGCGCGCTCCCGACAGTGCTCCTTCAGCCAGGACTTCCGTCATGAAAGTAAAACCGGAAGTCAGAAGAGTTCTGACAGGCATGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)