Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL220d12.3                            5 END     2          50       40                (no blast hit)

 This cluster: approximate FL confidence score = 91%

 1012784764 Xl3.1-IMAGE:6318512.5 - 4 ESTs
                                                                       .....-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6318512.5                                                                                                                              TCCATTCTAACAGCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTTGCACCATATGGGAGTGATCCTTTTGACAAACCACCCTGTAAAGGATGTTCATCATATCTCATGGAACCATACATTAAATGTGCAGAATGTGGACCTCCTGAATTTCTTCTCTGTTTACAGTGCTTTTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCATGACTTCAGATTTTGCCATCCTAGATCCCAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAGGCAGTAATGGATTGTGGATTTGGTAACTGGCAAGATGTAGCCAATCAGATGCGGACCAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGTACGTTGCTGAATCTAAAGCAAGCAGAGGAGGAAATGAATATGGACACCGCAGTTCCCTTTCATCCTGCAGATGACCCACCAAGACCAACCTTTGACTCTCTCTTGTCCAGGGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATTGATTTTGCTGAAGACGATTCTGATATTTTGCATGCCCTGAAAATCGCAGTTGTGGACATCTATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGGAGATGGCCAGGAAGGAGAAATCGAGCGCTGCACGATGGATCGTTGACGTGTCGCCTTTTCTGAAGAGAGCGCCAGCGGAGTTTCTGTACATTATTTCTTAATAAAGACTTTCCGGTTTTAAAGTTTCCCCAAAAAAAAAAAAAACAACAAAAAAAAAAAAAACAAAAACCCACAAAAAACAAAAAACCACCAAAACAAAAACACAAAAAAACCAA
                                                  Xl3.1-CHK-1012708961                                                                                                                                    CTAACAGCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTTGCACCATATGGGAGTGATCCTTTTGACAAACCACCCTGTAAAGGATGTTCATCATATCTCATGGAACCATACATTAAATGTGCAGAATGTGGACCTCCTGAATTTCTTCTCTGTTTACAGTGCTTTTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCATGACTTCAGATTTTGCCATCCTAGATCCCAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAGGCAGTAATGGATTGTGGATTTGGTAACTGGCAAGATGTAGCCAATCAGATGCGGACCAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGTACGTTGCTGAATCTAAAGCAAGCAGAGGAGGAAATGAATATGGACACCGCAGTTCCCTTTCATCCTGCAGATGACCCACCAAGACCAACCTTTGACTCTCTCTTGTCCAGGGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATTGATTTTGCTGAAGACGATTCTGATATTTTGCATGCCCTGAAAATCGCAGTTGTGGACATCTATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGGAGATGGCCAGGAAGGAGAAATCGAGCGCTGCACGATGGATCGTTGACGTGTCGCCTTTTCTGAAGAGAGCGCCAGCGGAGTTTCTGTACATTATTTCTTAATAAAGACTTTCCGGTTTTAAAGTTTCCCCAAAAAAAAAAAAAACAACAAAAAAAAAAAAAACAAAAACCCACAAAAAACAAAAAACCACCAAAACAAAAACACAAAAAAACCAAAACAAA
                                                      consensus depths                                                                                                                                   1     1     1     1     2     2     2     2     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      40     200                                                                                                                              
                                               BLH MIN      40     121                                                                                                                              
                                               BLH OVR      40     238                                                                                                                              
                                               ORF LNG      40       9                                                                                                                              
                                                                                                                                                                                                                                                              PROTEIN -== Ce ==== 2e-009     NP_001022134.1 F32A5.1b [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- At ---- 1e-029     NP_974561.1 transcriptional adaptor (ADA2b) [Arabidopsis thaliana] -------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Ag ==== 3e-030     XP_312792.4 AGAP003109-PA [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN --- Dm ==== 7e-033     NP_001027151.1 CG9638-PB, isoform B [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 1e-051     XP_001177198.1 PREDICTED: similar to transcriptional adaptor 2 (ADA2 homolog, yeast)-like [Strongylocentrotus purpuratus] ------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Dr ==== 3e-110     NP_001070609.1 hypothetical protein LOC555494 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Gg ==== 4e-113     NP_001012825.1 similar to Transcriptional adapter 2-like (ADA2-like protein) (KL04P) [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Mm ==== 7e-118     NP_766150.1 transcriptional adaptor 2 (ADA2 homolog, yeast)-like [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Cf ==== 1e-118     XP_853578.1 PREDICTED: similar to Transcriptional adapter 2-like (ADA2-like protein) isoform 2 [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Hs ==== 2e-120     NP_001479.3 transcriptional adaptor 2-like isoform a [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Bt ==== 1e-120     NP_001029416.1 hypothetical protein LOC505401 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xt ==== 9e-132     AAH80357.1 Transcriptional adaptor 2 (ADA2 homolog, yeast)-like [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 2e-145     NP_001087477.1 MGC81519 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6318512.5                                                                                                                                     TAA------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------ATG---------------------------------------ATG------------------------------------ATG------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2      seed Ov1  5g                         IMAGE:6318512.5p                                                                                                                              TCCATTCTAACAGCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTTGCACCATATGGGAGTGATCCTTTTGACAAACCACCCTGTAAAGGATGTTCATCATATCTCATGGAACCATACATTAAATGTGCAGAATGTGGACCTCCTGAATTTCTTCTCTGTTTACAGTGCTTTTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCATGACTTCAGATTTTGCCATCCTAGATCCCAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAGGCAGTAATGGATTGTGGATTTGGTAACTGGCAAGATGTAGCCAATCAGATGCGGACCAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGTACGTTGCTGAATCTAAAGCAAGCAGAGGAGGAAATGAATATGGACACCGCAGTTCCCTTTCATCCTGCAGATGACCCACCAAGACCAACCTTTGACTCTCTCTTGTCCAGGGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATTGATTTTGCTGAAGACGATTCTGATATTTTGCATGCCCTGAAAATCGCAGTTGTGGACATCTATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCACGGNCCTTATAAATCTTANGAAATTTCAAATTTTAGAAANCGACGGTATCCCAANGCATGTCCCAAGAGCTTTTATGATGCTATGGAGGNAGATTTTGCCCAGGGATATTTGNGGGGCCCATATGAC
  5   1   2       bld DMZ  5g3  out                        xl325d14.5p                                                                                                                                                      GAAAGAAAGGAAAGCAATGGACCGGCTTGCACCATATGGGAGTGATCCTTTTGACAAACCACCCTGTAAAGGATGTTCATCATATCTCATGGAACCATACATTAAATGTGCAGAATGTGGACCTCCTGAATTTCTTCTCTGTTTACAGTGCTTTTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCATGACTTCAGATTTTGCCATCCTAGATCCCAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAGGCAGTAATGGATTGTGGATTTGGTAACTGGCAAGATGTAGCCAATCAGATGCGGACCAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGTACCTTGCTGAATCTAAAGCAAGCAGAGGAGGAAATGAATATGGACACCGCAGTTCCCTTTCATCCTGCAGATGACCCACCAAGACCAACCTTTGACTCTCTCTTGTCCAGGGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATTGATTTTGCTGAAGACGATTCTGATATTTTGCATGCCCTGAAAATCGCAGTTGTGGACATCTATCATTCACGGTTAAAGGAAAGGCAGAGAA
  5   1   2       bld Emb1                            IMAGE:6637373.5p                                                                                                                                                                     AAAGAATGGACCGGCTTGCACCATATGGGAGTGATCCTTTTGACAACCACCCTGTAAAGGATGTTCATCATATCTCATGGAACCATACATTAAATGTGCAGAATGTGGACCTCCTGAATTTCTTCTCTGTTTACAGTGCTTTTCAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCATGACTTCAGATTTTGCCATCCTAGATCCCAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAGGCAGTAATGGATTGTGGATTTGGTAACTGGCAAGATGTAGCCAATCAGATGCGGACCAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGTACGTTGCTGAATCTAAAGCAAGCAGAGGAGGAAATGAATATGGACACCGCAGTTCCCTTTCATCCTGCAGATGACCCACCAAGACCAACCTTTGACTCTCTCTTGTCCAGGGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATTGATTTTGCTGAAGACGATTCTGATATTTTGCATGCCCTGAAAATCGCAGTTGTGGACATCTATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGGAGATGGCCAGGAAGGAGAAATCGAGCGCTGCACGATGGATCGTTGACGTGTCGCCTTTTCTGAAGAGAGCGCCAGCGGAGTTTCTGTACATTATTTCTTAATAAAGACTTTCCGGTTTTAAAGTTTCCCCaaaaaaaaaaaaaacaacaaaaaaaaaaaaaacaaaaacccacaaaaaacaaaaaaccaccaaaacaaaaacacaaaaaaaccaaaacaaaaa
  5   1   2       bld Ga12      out                        XL220d12.5p                                                                                                                                                                         GACCGGCTTGCACCATATGGGAGTGATCCTTTTGACAAACCACCCTGTAAAGGATGTTCATCATATCTCATGGAACCATACATTAAATGTGCAGAATGTGGACCTCCTGAATTTCTTCTCTGTTTACAGTGCTTTTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCATGACTTCAGATTTTGCCATCCTAGATCCCAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAGGCAGTAATGGATTGTGGATTTGGTAACTGGCAAGATGTAGCCAATCAGATGCGGACCAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGTACGTTGCTGAATCTAAAGCAAGCAGAGGAGGAAATGAATATGGGACACCGCAGTTCCCTTTCATCCTGCAGATGACCCACCAAGACCAACCTTTGACTCTCTCTTGTCCAGGGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATTGATTTTGCTGAAGACGATTCTGATATTTTGCATGCCCTGAAAATCGCAGTTGTGGACATCTATCATTCACGGTTAAAGGAAAGGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)