Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5084993.5.5                   100 END     1          10        1                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:6326901.5                      64 END     1          10        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6326901.5                      64 PI      84          1      684                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012784903 Xl3.1-PBX0166C03.5 - 10 ESTs
                                                                       -30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-PBX0166C03.5                               TGACTAAATTATGCCCTACAGATGGTAAATTGAAGCATGCTTAAACCTTGAAGATGTTTTTTAAAAAATTCTTGCTCTGTAGGTTTTCTTTATTCCAGACAATGGATTTTTTTTTCTTTTTTTCCTTTAATACAAGTAGGATGTCTTTTTTTCCATGGTTTACCCTGTCTTATAGACTTTAAAGCATTGAGTTTAGAACTACCCTAGAGCCAACATAGATCATTTTAGACTTCATAAAGTGAAGATCATTAATAGCAGCATGTCTATTTATTATATGTGCAATCCCATGTAAGACATGACTGACTGTGATTAGTCTTAAGTAGTCAAGTACCCTTTGTCTTTTCCTTTAAGAAAATACATTTATGTTTTGGTTTTAAATGAAGGTTTATGTTGGCATGTGTGGAAATGTGACTGCTTAGACTCTACCTTGCCCATATTTTGTTGGTTGTTGGGATTGTAAATACCAATTAAGTCCAAAGTAAAAACACCTTCTGCCAGCTTCCCCCCCCATCTCATTCAGGTTCTGCTAAATGAAAACAATGTATAAAGGAGAACAAAAGATGAGATCTCCACAAGCATCATTTAAACTGTAAATATTATATATATTACAATTGGATTAATCTGGCTGAATAATATTTTCGTTTATTCTATTGCTCCTTTATGGGACCCTATTTCTAAGAGAGAATAACTGCTCAATCTATTTTTTTTTTTTTTTTTTTTTGCAATTTTGAATTCTTCTTTATTTTTTTGTTATATTTTCATTAGCCCATAGAATATTCGGGATGGACCAAAAAGTTCATAACACAATCTATTCCAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGTTTTTTGATATAGTTTTTGATATAGTTTTTCTTTTTTAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAGTTTAAAAAAATCTAACACTCTTCCCAAATATCAGTTTTGTTTATGTTGATTTTGTTTCTTTTGTTTTTTTTGTGTTTTGTTT
                                                  Xl3.1-CHK-1012695498                                     AATTATGCCCTACAGATGGTAAATTGAAGCATGCTTAAACCTTGAAGATGTTTTTTAAAAAATTCTTGCTCTGTAGGTTTTCTTTATTCCAGACAATGGATTTTTTTTTCTTTTTTTCCTTTAATACAAGTAGGATGTCTTTTTTTCCATGGTTTACCCTGTCTTATAGACTTTAAAGCATTGAGTTTAGAACTACCCTAGAGCCAACATAGATCATTTTAGACTTCATAAAGTGAAGATCATTAATAGCAGCATGTCTATTTATTATATGTGCAATCCCATGTAAGACATGACTGACTGTGATTAGTCTTAAGTAGTCAAGTACCCTTTGTCTTTTCCTTTAAGAAAATACATTTATGTTTTGGTTTTAAATGAAGGTTTATGTTGGCATGTGTGGAAATGTGACTGCTTAGACTCTACCTTGCCCATATTTTGTTGGTTGTTGGGATTGTAAATACCAATTAAGTCCAAAGTAAAAACACCTTCTGCCAGCTTCCCCCCCCATCTCATTCAGGTTCTGCTAAATGAAAACAATGTATAAAGGAGAACAAAAGATGAGATCTCCACAAGCATCATTTAAACTGTAAATATTATATATATTACAATTGGATTAATCTGGCTGAATAATATTTTCGTTTATTCTATTGCTCCTTTATGGGACCCTATTTCTAAGAGAGAATAACTGCTCAATCTATTTTTTTTTTTTTTTTTTTTTGCAATTTTGAATTCTTCTTTATTTTTTTGTTATATTTTCATTAGCCCATAGAATATTCGGGATGGACCAAAAAGTTCATAACACAATCTATTCCAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGTTTTTTGATATAGTTTTTGATATAGTTTTTTTTTTTTAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAGTTTAAAAAAATCTAACACTCTTCCCAAATATCAGTTTTGTTTATGTTGATTTTGTTTCTTTTGTTTTTTTTGTGTTTTGTTTTGTTTG
                                                      consensus depths                                    2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     2     3     3     3     3     4     2     3     1     3     1     3     2     3     4     4     4     5     4     5     4     5     4     5     4     5     3     5     6     6     6     6     7     7     7     7     7     8     8     8     8     8     8     8     7     8     8     8     8     8     7     8     8     8     8     8     8     8     6     7     6     7     7     7     7     7     7     7     6     7     7     7     5     7     5     7     5     7     5     7     4     7     3     7     3     7     3     7     4     7     2     5     4     4     2     4
                                                    Xl3.1-PBX0166C03.5                               TGA------------------ATG------TGA---ATG---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------TAG------TAA------------TAATAG---------------------------------------------TGA---TGA---------------------------------------------------------------------TGA------ATG---------------ATGTGA---------------------------------------------------------TAA------------------------------------------------------------TGA---------------------------TGA------------------------------------------------------------------TAA---------------------------ATG------------TAA------------------------------------------------------------------------------------TAG------------------------------------------------------------TAA------------------ATG---------------------ATG---------ATG------------------------TAA------TAA---------------------------------TAA------------------TAA---------------------------------------ATG------------------------------------------TAA---TAA------------------------TAA------------------------------------------------------------------TGA
  3   1   2      skin Neu7                                 XL003g20.3p TTAAGTATACAAATAAAATATAGATAGTTTTGACTAAATTATGCCCTACAGATGGTAAATTGAAGCATGCTTAAACCTTGAAGATGTTTTTTAAAAAANTCTTGCTCTGTAGGTTTTCTTTATTCCAGACAATGGATTTTTTTTTCTTTTTTTCCTTTAATACAAGTAGGATGTCTTTTTTTCCATGGTTTACCCTGTCTTATAGACTTTAAAGCATTGAGTTTAGAACTACCCTAGAGCCAACATAGATCATTTTAGACTTCATAAAGTGAAGATCATTAATAGCAGCATGTCTATTTATTATATGTGCAATCCCATGTAAGACATGACTGACTGTGATTAGTCTTAAGCAGTCAAGNACCCTTTGTCTTTTCCTTTAAGAAAATACATTTATGTTTTGGTTTTAAATGAAGGTTTATGTTGGCATGTGTGGAAATGTGACTGCTTAGACTCTACCTTGCCCATATTNNTGTTGGTTGTTGGGATTGTAAATNCCAATTAAGTCCAAAGTA
  5   1   2      skin Neu7                                 XL048d23.5p                   GATAGATAGTTTTGACTAAATTATGCCCTACAGATGGTAAATTGAAGCATGCTTAAACCTTGAAGATGTTTTTTAAAAAATTCTTGCTCTGTAGGTTTTCTTTATTCCAGACAATGGAtttttttttctttttttCCTTTAATACAAGTAGGATGTCTTTTTTTCCATGGTTTACCCTGTCTTATAGACTTTAAAGCATTGAGTTTAGAACTACCCTAGAGCCAACATAGATCATTTTAGACTTCATAAAGTGAAGATCATTAATAGCAGCATGTCTATTTATTATATGTGCAATCCCATGTAAGACATGACTGACTGTGATTAGTCTTAAGTAGTCAAGTACCCTTTGTCTTTTCCTTTAAGAAAATACATTTATGTTTTGGTTTTAAATGAAGGTTTATGTTGGCATGTGTGGAAATGTGACTGCTTAGACTCTACCTTGCCCATATTTTGTTGGTTGTTGGGATTGTAAATACCAATTAAGTCCAAAGTAAAAACACCTTCTGCCAGCTTccccccccATCTCATTCAGGTTCTGCTAAATGAAAACAATGTATAAAGGAGAACAAAAGATGAGATCTCCACAAGCATCATTTAAACTGTAAATATTATATATATTACAATTGGATTAATCTGGCTGAATAATATTTTCGTTTATTCTATTGCTCCTTT
  5   1   2       bld Gas5                            IMAGE:3749932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAAATGAAAACAATGTATAAAGGAGAACAAAAGATGAGATCTCCACAAGCATCATTTAAACTGTAAATATTATATATATTACAATTGGATTAATCTGGCTGAATAATATTTTCGTTTATTCTATTGCTCCTTTATGGGACCCTATTTCTAAGAGAGAATAACTGCTCAATCTAtttttttttttttttttttttgcaattttgaattcttctttatttttttgttatattttCATTAGCCCATAGAATATTCGGGATGGACCAAAAAGTTCATAACACAATCTATTCCAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGGATCATTTGGATTAATATAGATTCCTTGTTCATTAAACAT
  3   1   2       add DMZ       out                        xl268l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCATTTAAACGGTAAATATTATATATNTTACAATTGGNTTAATCTGGNTGAANAATATTTTCGNTTATTCTATTGCTCCNTTATGGGACCCTATTTNTAAGNGNGNANAACTGNNCNATCTATTTTTGnTTTTATTTTTTTTTGCAATTTTGAATTCTTCTTTATTTTTTTGnTATATTTTCATTAGCCCATAGAATATTCGGGANGGNCCAAAAAGTTCATAACNCAATCTATTCCAATACTATATTAAAGTCCAAGTAGNGCNTTCATGNATCTATTCTTGATTGATTTTATGNGGCATGTAATGTTTGCCNTGNGGTACATCGTAAATTAATTTAAATAAGCNTCCNGTTATTATATAAAGTATCATTTGGNTTAATATAGNTTCCTTGTTCNTTAAACNTTTGNGCNTTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGTTTTTTGATATAGTTTTTGATATAGnTTTTTTTTTTAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAGTTTAAAAAAATCTAACACTCTTCCCAAATATCAGTTTTGTTTATGTTGATTTTGTTTCTTTTGTTTTTTTTGTGTTTTGTTTTGTTG
  5   1   2       bld Egg1                               PBX0166C03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCACCAGGCTTTATGGGACCCTATTTCTAAGAGAGAATAACTGCTCAATCTAttttttttttttttttttttttgcaattttgaattcttctttatttttttgttatattttCATTAGCCCATAGAATATTCGGGATGGACCAAAAAGTTCATAACACAATCTATTCCAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGtttttttatatagtttttgatatagttttttttttttAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAATTTAAAAAAATCTAACACTCTTCCCAAATATCAATTTTGTTTATGTTGATT
  3   1   2      seed Tbd7                                 XL100j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTTTTTTTTTATTTTTTTTTGCAATTTTGAATTCTTCTTTATTTTTTTGTTATATTTTCATTAGCCCATAGAATATTCGGGATGGACCAAAAAGTTCATAACACAATCTATTCCAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGTTTTTTGATATAGTTTTTGATATAGTTTTTCTTTTTTAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAGTTTAAAAAAATCTAACACTCTTCCCAAATATCAGTTTTGTTTATGTTGATTTTGTTTCTTTTGTTTTTTTTGTGTTTTGTTTTGTTGTTTACTTTNGCATTNATCATTAA
  3   1   2       bld Neu7 5x3  out                        XL027h05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTTTTTTTTGCAATTTTGAATTCTTCTTTATTTTTNTGTTAAATTTTCATTAGCCCATAGAATATTCGGGATGGACCAAAAAAGTTCATAACACAATCTATTCCAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGTTTTTTGATATAGTTTTTGATATAGTTTTTCTTTTTTAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAGTTTAAAAANATCTANCACTCNTCCCAAATANCAGTTTTGTNTATGTTG
  5   1   2       bld Oo1                             IMAGE:6639704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCATCCAAAAAGTTCATAACACAATCTATTCCAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTgtttttttatatagtttttgatatagttttttttttttAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAGTTTAAAAAAATCTAACACTCTTCCCAAATATCagttttgtttatgttgattttgtttcttttgttttttttgtgttttgttttgtttgttttacttttgcatttatcattaaatttgattttgttttgctcaacttttggtttttttttttttttttggtttggtttgttttttttctttcttttAAGNAATTTGCTGCCTAGGGCATTGAGTTCATTCCTTTTAATAGGTTTTATATACATTTCAAATATCTTGCTAATAGAGGTCCTAACATTTTAATGATAAATAATTTGTGCTATTGGAATAAATGTGAGTTCTTTTTACATTTAATTTTGATTTGTTTTCCCCTTGAACTTTATTGTAGCAACACAAACACCACTACAAATATTCTTGCTAAACTTTTCATTGCCAGCATTTTCAGTGGAGTAAGGGAAGCATCCCAAAACTGGAGACTCCTTTGCATGGAAGCCCTGGCCCCTGAAATACCCTGCATTGGAAAAGAATATTTTAATTCCTTTTTCCCAACCTTGGCCTTTTCAGCCCTATCATTCAGCTTTACTAATCGGAAATGGCCCAGGCCCCCCGGGGATCCTTAGGTACACTTATTTAGGGGGATTTAATAAATTCCCAGAAACTTCCAGGGGaaaaaaaaTGGCCCGGGCTACCAGGGGTTATGGGGGCCTCTCC
  3   1   2       bld Egg6                            IMAGE:4434628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATACTATATTAAAGTCCAAGTAGAGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGTAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGTTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGTTTTTTGATATAGTTTTTGATATAGTTTTTTTTTTTAACAGTAAAAACAGCAGAACCTATTTTCAAATTAAATATTAAGTTTGATTCCTAGTTTAAAAAAATCTAACACTCTTCCCAAATATCAGTTTTGTTTATGTTGATTTTGTTTCTTTTGTTTTTTTTGTGTTTTGTTTTGTTTGTTTTAC
  3   1   2       add Tbd7                                 XL071f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCATTCATGTATCTATTCTTGATTGATTTTATGTGGCATGNAATGTTTGCCTTGTGGTACATCGTAAATTAATTTAAATAAGCATCCAGNTATTATATAAAGTATCATTTGGATTAATATAGATTCCTTGTTCATTAAACATTTGAGCATTGCTTAGTTTTTCCTTTGCATCCCGTTATGGCCTTGTTTTTTGATATAGTTTnTGATATAGTTTTTCTTTTTTAACAGTAAAAACAGCAGAACCTATTTTCAAANTAAATATTAAGTTCTGATTCCTAGTTTAAAAAAATCTAACACTCTTCCCAAANATCAGTTTTGTTTATGTTGATTGTGTTTCTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)