Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL090h15.3                            3 END     2          40       66                Unknown (protein for MGC:52547) [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7211608.5                       3 PI      90        140      840                neurotrophic tyrosine kinase, receptor, type 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012784904 Xl3.1-IMAGE:6944839.5 - 5 ESTs
                                                                       ...-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6944839.5                                                                                                        CTCCATCTGGGTTTGTCTCTGAAGCTGAAATCCCTGCAGCCGTCCCAGCTGGGATTGGGAATCAGCATCCTTTTTTGTGCCGGACCTCCTGACATCCCATCATCAATAAACCTGCACTGATACTAAGAGGAGCGAGAGGTGAGCCGCTTCCAGTGAATGATCCCTGTCTCTACCTTGCGCTTGCTCGCCGGAGCTGACCTATGATGTGCATCACTTAGCGCATTTGGATTATGACTGTACCGACGCTTCGTCATTGATTTCCACTGATTCCCCCAACCCCGGACCTAGTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGATCCAGTGGACCTGACAGCCATAATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCACTTTAATGGACAAGGGGATTCCGGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCAGAGAACATCACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGATGATGTTAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGCAAGAACCTTAAACTTACATACATAAATTTCTCCAGAAATAAGCTAACATCTTTAACCAAGAAGATTTTTCGCCATCTGACCTTATCTCAGCTGCTTCTTGGTGGCAATCCTTTCCAGTGCTCGTGTGATTTAATGTGGG
                                                  Xl3.1-CHK-1012706099                                                                                                              CTGGGTTTGTCTCTGAAGCTGAAATCCCTGCAGCCGTCCCAGCTGGGATTGGGAATCAGCATCCTTTTTTGTGCCGGACCTCCTGACATCCCATCATCAATAAACCTGCACTGATACTAAGAGGAGCGAGAGGTGAGCCGCTTCCAGTGAATGATCCCTGTCTCTACCTTGCGCTTGCTCGCCGGAGCTGACCTATGATGTGCATCACTTAGCGCATTTGGATTATGACTGTACCGACGCTTCGTCATTGATTTCCACTGATTCCCCCAACCCCGGACCTAGTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGATCCAGTGGACCTGACAGCCATAATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCACTTTAATGGACAAGGGGATTCCGGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCAGAGAACATCACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGATGATGTTAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGCAAGAACCTTAAACTTACATACATAAATTTCTCCAGAAATAAGCTAACATCTTTAACCAAGAAGATTTTTCGCCATCTGACCTTATCTCAGCTGCTTCTTGGTGGCAATCCTTTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAG
                                                      consensus depths                                                                                                             2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG     368     398                                                                                                        
                                               BLH MIN     368      48                                                                                                        
                                               BLH MPR     287      48                                                                                                        
                                               BLH OVR     368     800                                                                                                        
                                               CDS MIN     368      48                                                                                                        
                                               ORF LNG     368      22                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - ?? ---- 9e-016     XP_613650.3 PREDICTED: neurotrophic tyrosine kinase, receptor, type 1 isoform 1 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Dr ---- 6e-030     XP_001919963.1 PREDICTED: si:ch211-220b11.1 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bt ==== 1e-045     NP_001068693.1 neurotrophic tyrosine kinase, receptor, type 2 [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN -== Gg ==== 1e-045     NP_990562.1 tyrosine kinase receptor [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 1e-045     NP_001020245.1 neurotrophic tyrosine kinase, receptor, type 2 isoform a [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 2e-046     NP_001018076.1 neurotrophic tyrosine kinase, receptor, type 2 isoform e precursor [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 5e-047     XP_848589.1 PREDICTED: similar to neurotrophic tyrosine kinase, receptor, type 2 isoform a precursor isoform 2 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 2e-080     NP_001072653.1 neurotrophic tyrosine kinase, receptor, type 2 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xl ==== 2e-089     AAH44959.1 Unknown (protein for MGC:52547) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6944839.5                                                                                                                                                                                                 TGA------------------------------------------------------------------------------------------------------TGA---ATGATG---------TAG------------ATG---------------------TGA---------------------------------------------------------------------------------TAG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2       bld Tbd7 5g3  out                        XL101a11.5p GGGATATTTTCTACCTGATGAATATGGATGCGCGGTGCATTGGGTTAGCTCCGATCGACAGCTTCTGGGTCTGCCCCAGGGATGAGTTGCTGCTTGGGCTGTAAATGACACCGATTTTTATTACCGTGTGTTTTTGTTTCTCCCCTAACAGCTGGGATTGGGAATCAGCATCCTTTTTTGTGCCGGACCTCCTGACATCCCATCATCAATAAACCTGCACTGATACTAAGAGGAGCGAGAGGTGAGCCGCTTCCAGTGAATGATCCCTGTCTCTACCTTGCGCTTGCTCGCCGGAGCTGACCTATGATGTGCATCACTTAGCGCATTTGGATTATGACTGTACCGACGCTTCGTCATTGATTTCCACTGATTCCCCCAACCCCGGACCTAGTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGATCCAGTGGACCTGACAGCCATAATGCGCC
  5   1   2       bld Eye1 5g                         IMAGE:6944839.5p                                                        gctggaccggtccggattctcgggatggcggTCAGTGCAGAAGCATCTCTCCATCTGGGTTTGTCTCTGAAGCTGAAATCCCTGCAGCCGTCCCAGCTGGGATTGGGAATCAGCATCCTTTTTTGTGCCGGACCTCCTGACATCCCATCATCAATAAACCTGCACTGATACTAAGAGGAGCGAGAGGTGAGCCGCTTCCAGTGAATGATCCCTGTCTCTACCTTGCGCTTGCTCGCCGGAGCTGACCTATGATGTGCATCACTTAGCGCATTTGGATTATGACTGTACCGACGCTTCGTCATTGATTTCCACTGATTCCCCCAACCCCGGACCTAGTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGATCCAGTGGACCTGACAGCCATAATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCACTTTAATGGACAAGGGGATTGCGGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCAGAGAACATCACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGATGATGTTAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGCAAGAACCTTAAACTTACATACATAAATTTCTCCAGAAATAAGCTAACATCTTTTAACAAGGAAGATTTTTCCGCCATCTGGACTTTTATCTCAGGCTGCTTTCTTGGTGGCAAATCCTTTTCCAGTTGCTCCTTGTGAAA
  5   1   2      seed Tbd7 5g3  out                        XL090h15.5p                                                                                                CACGAGGTCTCCATCTGGGTTTGTCTCTGAAGCTGAAATCCCTGCAGCCGTCCCAGCTGGGATTGGGAATCAGCATCCTTTTTTGTGCCGGACCTCCTGACATCCCATCATCAATAAACCTGCACTGATACTAAGAGGAGCGAGAGGTGAGCCGCTTCCAGTGAATGATCCCTGTCTCTACCTTGCGCTTGCTCGCCGGAGCTGACCTATGATGTGCATCACTTAGCGCATTTGGATTATGACTGTACCGACGCTTCGTCATTGATTTCCACTGATTCCCCCAACCCCGGACCTAGTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGATCCAGTGGACCTGACAGCCATAATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCC
  5   1   2       bld Emb4 5g                         IMAGE:4930174.5p                                                                                                                                                                                                                                                                                                                                               TGACTGTACCGACGCTTCGTCATTGATTTCCACTGATTCCCCCAACCCCGGACCTAGTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGATCCAGTGGACCTGACAGCCATAATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCACTTTAATGGACAAGGGGATTCCGGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCAGAGAACATCACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGATGATGTTAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGCAAGAACCTTAAACTTACATACATAAATTTCTCCAGAAATAAGCTAACATCTTTAACCAAGAAGATTTTTCGCCATCTGACCTTATCTCAGCTGCTTCTTGGTGGCAATCCTTTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAGTATTACTGGAGACTAATTCCCTGAACATGGAGAACCAAAATATACACTGCTTCAATGACAACAAAAAGAAGATTCCTCTCTTCAATATGCACATACCCAACTGTGGGTTGCCTATAGCAAATGTGAGTACGATAAATATCACAGTTCCTGAAAGTAAATGAGACACCCTGTACTGTGATGCCAACGGGACTCCCAGACCCCAATGTCCTCCTGGGGATATCTCACAAGATCATTTTCaaaaaaaaT
  5   1   2       bld Emb4 5g                IMAGE:4930174-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGGACCTGACAGCCATAATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCACTTTAATGGACAAGGGGATTCCGGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCAGAGAACATCACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGATGATGTTAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGCAAGAACCTTAAACTTACATACATAAATTTCTCCAGAAATAAGCTAACATCTTTAACCAAGAAGATTTTTCGCCATCTGACCTTATCTCAGCTGCTTCTTGGTGGCAATCCTTTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)