Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:8321006.5                       4 END     1          20       25                hypothetical protein LOC398750 [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:5511913.5                       3 END     1          20       33                exostoses (multiple) 2 [Xenopus laevis]
     3   2.0    0Xl3.1-IMAGE:4031455.5                       3 END     1          20       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:8318299.5                       2 PI      94          2      394                hypothetical protein LOC398750 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012784984 Xl3.1-IMAGE:8529721.5 - 5 ESTs
                                                                       .........-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8529721.5                                                            CGAGGTGTCGATGGTTCTGACGGGTGCAGCTTTCTACCACAAGTACTTCAACTACCTGTACACCTACAAGATGCCCGGGGACATCAAGAACTGGGTCGACGCCCACATGAACTGCGAAGATATCGCCATGAACTTCTTAGTGGCCAACGTGACAGGCAAGGCACCTATTAAGGTGACTCCGAGAAAGAAGTTCAAGTGCCCAGAATGCACGGCCATCGATGGGCTGTCACTGGATCAGACGCACATGGTGGAGAGATCTGAATGTATCAACAAGTTTGCGTCGGTTTTCGGCACCATGCCCCTGAAGGTGGTGGAGCACCGTGCTGACCCCGTGCTGTACAAGGACGACTTCCCAGAGAAGCTGAAGAGTTTCCCCAACATCGGCAGCCTGTGAGAATGTCGCCGAGCAACCGCATCTTCACTTTGCGGCACTGCTGCACCGTCACCCTGGCCCCTAGTCTTTCCTTTTCACACGTTTTATTGGTGATTTTAACACGTCTCTCCTAGCTGCTCTCTCTACTTATTATGGTCGGACTTGTTATAGGGATAAGATAAACCTACAACGTGTTTTATATTAAATACCTGCCGGCAACCAATTAGAATCCACTGAGAATATCGCAGAGCCTTTATTGGACACCGTGTCATGGGAATATATAATATATTCATCTATATAACTGCTCATTACAAGCAGAAACACAATGAGCTTGATATAGAAACGGCTGCCGGTCGCCATGTTTATTTTCCCAGAATTCCACTTTCTCACATAGTGGTGACTGTCTCCCACGTAAGTGACCGGTCTCAGCCAATCATATATTTGCTTTCACTCATAAGACGCAGCTGATTGGTGGAGCTCATACCCCCTACTATACACTCACCCACACCCGCATCTTTCAGGGACTCTTTCTCATAGATGTGCATTTCGTT
                                                  Xl3.1-CHK-1012703789                                                                  GTCGATGGTTCTGACGGGTGCAGCTTTCTACCACAAGTACTTCAACTACCTGTACACCTACAAGATGCCCGGGGACATCAAGAACTGGGTCGACGCCCACATGAACTGCGAAGATATCGCCATGAACTTCTTAGTGGCCAACGTGACAGGCAAGGCACCTATTAAGGTGACTCCGAGAAAGAAGTTCAAGTGCCCAGAATGCACGGCCATCGATGGGCTGTCACTGGATCAGACGCACATGGTGGAGAGATCTGAATGTATCAACAAGTTTGCGTCGGTTTTCGGCACCATGCCCCTGAAGGTGGTGGAGCACCGTGCTGACCCCGTGCTGTACAAGGACGACTTCCCAGAGAAGCTGAAGAGTTTCCCCAACATCGGCAGCCTGTGAGAATGTCGCCGAGCAACCGCATCTTCACTTTGCGGCACTGCTGCACCGTCACCCTGGCCCCTAGTCTTTCCTTTTCACACGTTTTATTGGTGATTTTAACACGTCTCTCCTAGCTGCTCTCTCTACTTATTATGGTCGGACTTGTTATAGGGATAAGATAAACCTACAACGTGTTTTATATTAAATACCTGCCGGCAACCAATTAGAATCCACTGAGAATATCGCAGAGCCTTTATTGGACACCGTGTCATGGGAATATATAATATATTCATCTATATAACTGCTCATTACAAGCAGAAACACAATGAGCTTGATATAGAAACGGCTGCCGGTCGCCATGTTTATTTTCCCAGAATTCCACTTTCTCACATAGTGGTGACTGTCTCCCACGTAAGTGACCGGTCTCAGCCAATCATATATTTGCTTTCACTCATAAGACGCAGCTGATTGGTGGAGCTCATACCCCCTACTATACACTCACCCACACCCGCATCTTTCAGGGACTCTTTCTCATAGATGTGCATTTCGTTCTCTTT
                                                      consensus depths                                                                 2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  3   1   2       bld Tbd7      out                        XL072j21.3p CGGCTGCACCTGTGGGATCATGAAATGAGCAAGTGGAAATATGAATCCGAGTGGACAAACGAGGTGTCGATGGTTCTGACGGGTGCAGCTTTCTACCACAAGTACTTCAACTACCTGTACACCTACAAGATGCCCGGGGACATCAAGAACTGGGTCGACGCCCACATGAACTGCGAAGATATCGCCATGAACTTCTTAGTGGCCAACGTGACAGGCAAGGCACCTATTAAGGTGACTCCGAGAAAGAAGTTCAAGTGCCCAGAATGCACGGCCATCGATGGGCTGTCACTGGATCAGACGCACATGGTGGAGAGATCTGAATGTATCAACAAGTTTGCGTCGGTTTTCGGCACCATGCCCCTGAAGGTGGTGGAGCACCGTGCTGACCCCGTGCTGTACAAGGACGACTTCCCAGAGAAGCTGAAGAGTTTCCCCAACATCGGCAGCCTGTGAGAATGTCGCCGAGCAACCGCATCTTCACTTTGCGGCACTGCTGCACCGTCACCCTGGCCCCTAGTCTTTCCTTTTCACACGTTTTATTGGTGATTTTAACACGTCTCTCCTAGCTGCTCTCTCTACTTATTATGGTCGGACTTGTTATAGGGATAAGATAAACCTACAACGTGTTTTATATTAAATACCTGCCGNC
  5   1   2      seed Int2                            IMAGE:8529721.5p                                                            CGAGGTGTCGATGGTTCTGACGGGTGCAGCTTTCTACCACAAGTACTTCAACTACCTGTACACCTACAAGATGCCCGGGGACATCAAGAACTGGGTCGACGCCCACATGAACTGCGAAGATATCGCCATGAACTTCTTAGTGGCCAACGTGACAGGCAAGGCACCTATTAAGGTGACTCCGAGAAAGAAGTTCAAGTGCCCAGAATGCACGGCCATCGATGGGCTGTCACTGGATCAGACGCACATGGTGGAGAGATCTGAATGTATCAACAAGTTTGCGTCGGTTTTCGGCACCATGCCCCTGAAGGTGGTGGAGCACCGTGCTGACCCCGTGCTGTACAAGGACGACTTCCCAGAGAAGCTGAAGAGTTTCCCCAACATCGGCAGCCTGTGAGAATGTCGCCGAGCAACCGCATCTTCACTTTGCGGCACTGCTGCACCGTCACCCTGGCCCCTAGTCTTTCCTTTTCACACGTTTTATTGGTGATTTTAACACGTCTCTCCTAGCTGCTCTCTCTACTTATTATGGTCGGACTTGTTATAGGGATAAGATAAACCTACAACGTGTTTTATATTAAATACCTGCCGGCAACCAATCAGAATCCACTGAGAATATCGCAGAGCCTTTATTGGACACCGTGTCATGGGAATATATAATATATTCATCTATATAACTGCTCATTANCAGCAGAAACACAATGAGCTTGATATAGAAACAGCTGCCGGTCGCCATGTTTATTTC
  5   1   2       bld Ga18      out                     xlk138j18ex.5p                                                                                                                       TACACCTACAAGATGCCCGGGGACATCAAGAACTGGGTCGACGCCCACATGAACTGCGAAGATATCGCCATGAACTTCTTAGTGGCCAACGTGACAGGCANNNNCCTATTAAGGTGACTCCGAGAAAGAAGTTCAAGTGCCCAGAATGCACGGCCATCGATGGGCTGTCACTGGATCAGACGCACATGGTGGAGAGATCTGAATGTATCAACAAGTTTGCGTCGGTTTTCGGCACCATGCCCCTGAAGGTGGTGGAGCACCGTGCTGACCCCGTGCTGTACAAGGACGACTTCCCAGAGAAGCTGAAGAGTTTCCCCAACATCGGCAGCCTGTGAGAATGTCGCCGAGCAACCGCATCTTCACTTTGCGGCACTGCTGCACCGTCACCCTGGCCCCTAGTCTTTCCATTTCACACGTTTTATTGGTGATTTTAACACGTCTCTCCTAGCTGCTCTCTCTACTTATTATGGTCGGACTTGTTATAGGGATAAGATAAACCTACAACGTGTTTTATATTAAATACCTGCCGGCNANCNAANCAGAATCCACTGAGAATATCGCNGNNNNTTATTGGACACCGTGTCATGGGAATATATAATATATTCATCTATATAACTGCTCATTACAAGCAGAAACACAATGAGCTTGATATAGAAACAGCTGCCGGNCGNCATGTTTATTTCCCCAGAATTCCACTTTCTCACNTAGTGGTGACTGTCTCCNA
  3   1   2       bld Tbd7 5g3  out                        XL052m20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACNGTCACCCTGGCCCCTAGTCTTTCCATTTCACACGTTTTATTGGTGATTTTAACANGTCTCTCCTAGNTGCTCTCTNTACTTATTATGGTCGGACTTGTTATAGGGATAAGATAAACCTACAACGTGTTTTATATTAAATACCTGCCGGCAACCAATTAGAATCCACTGAGAATATCGCAGAGCCTTTATTGGACACCGTGTCATGGGAATATATAATATATTCATCTATATAACTGCTCATTACAAGCAGAAACACAATGAGCTTGATATAGAAACGGCTGCCGGTCGCCATGTTTATTTTCCCAGAATTCCACTTTCTCACATAGTGGTGACTGTCTCCCACGTAAGTGACCGGTCTCAGCCAATCATATATTTGCTTTCACTCATAAGACGCAGCTGATTGGTGGAGCTCATACCCCCTACTATACACTCACCCACACCCGCATCTTTCAGGGACTCTTTCTCATAGATGTGCATTTCGTTCTCTTTTATATTGGTCATGTTTTTATATTATTATGTTTTTTTTAGnCATTTTAAATATTTTTTTTA
  3   1   2       bld Tbd7                                 XL063n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGCTCTCTCTACTTATTATGGTCGGACTTGTTATAGGGATAAGATAAACCTACAACGTGTTTTATATTAAATACCTGCCGGCAACCAATTAGAATCCACTGAGAATATCGCAGAGCCTTTATTGGACACCGTGTCATGGGAATATATAATATATTCATCTATATAACTGCTCATTACAAGCAGAAACACAATGAGCTTGATATAGAAACGGCTGCCGGTCGCCATGTTTATTTTCCCAGAATTCAACTTTCTCACATAGTGGTGACTGTCTCCCACGTAAGTGACCGGTCTCAGCCAATCATATATTTGCTTTCACTCATAAGACGCAGCTGATTGGTGGAGCTCATACCCCCTACTATACACTCACCCACACCCGCATCTTTCAGGGACTCTTTCTCATAGATGTGCATTTCGTTCTCTTTTATATGGTCATGTTTTTATATTATTATGTTTTTTTTAGCATTTTAAATATTTAGTTTTAAAGATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)