Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL096m13.5                            6 END     2          28       33                (no blast hit)
     2   1.0    0Xl3.1-IMAGE:4033122-IMAGp.5                 4 END     1          14       25                hypothetical protein LOC398842 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:4031203.5                       4 PI      90          1      901                HNF1 homeobox b [Danio rerio]

 This cluster: approximate FL confidence score = 97%

 1012785014 Xl3.1-IMAGE:7008901.5 - 7 ESTs
                                                                       ........-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7008901.5                                                                                                                                                                                                                                                                                                                                                             GACTCTCTGCGGGGACGTTGTCTGTGAGCACAAGAGGAACAGGTGCTCTGGGACAAGGGGATTCCAGATCCCTCTTTTTTTTATTACTCCCCTGTCCCCTTTCCTTCTTTTTTTCCCTTGAAAATGGTGTCCAAGCTATCGCCTTTGCAGCAGGAACTCCTCAATGCTCTCCTCAACTCTGGAGTAACCAAAGAGGATCTGATCCAGGCCTTGGACGATATGATTCCCAGCCCAAGCTTTGGGGTGAAGCTGGAAAACTTGCACATGTCCCCGGAACATGAATCTGACAATAAACCCGTATTCCACACTCTCACCAATGGCCACCACCATAAGGGCAAACTCTCCGGGGATGAGGGCTCTGAGGATGGAGATGACTTTGATACCCCTCCAATACTTAAAGAACTGCAGTCCCTCAATACGGAGGAGGCAGCTGAGCAAAGGGCAGAAGTGGACAGAATGTTGAGCGAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAACATTTAAACAAAGGAACACCAATGAAGACCCAAAAACGTGCTGCATTGTACACTTGGTATGTGAGGAAACAAAGGGAGATAGTAATACAATTCAACCAGACAGTCCAGGGTTCTGGAAATATTACAGACAAAAGCAGTCAGGATCAGCTGCTGTTTCTCTTTCCAGAGTTTAATCAGCAAAATCCAGTCCCAGGACAGCCTGACGATTCCTGCTCAGAGCCTGCCAACAAGAAGATGAGACGAAATCGTTTCAAGTGGGGGCCTGCATCACAGCATATTCTTTACCAAGCCTATGAAAGGCAAAAGAATCCCAGCAAAGAAGAAAGAGAAGCTTTAGTGGAAGAGTGTAATAGAGCGGAATGTATTCAACGTGGTGTATCTCCATCTAAAGCTCATGGCCTTGGATCAAATTTGGTAACAGAAGTCCGTGTT
                                                  Xl3.1-CHK-1012699835                                                                                                                                                                                                                                                                                                                                                                   CTGCGGGGACGTTGTCTGTGAGCACAAGAGGAACAGGTGCTCTGGGACAAGGGGATTCCAGATCCCTCTTTTTTTTATTACTCCCCTGTCCCCTTTCCTTCTTTTTTTCCCTTGAAAATGGTGTCCAAGCTATCGCCTTTGCAGCAGGAACTCCTCAATGCTCTCCTCAACTCTGGAGTAACCAAAGAGGATCTGATCCAGGCCTTGGACGATATGATTCCCAGCCCAAGCTTTGGGGTGAAGCTGGAAAACTTGCACATGTCCCCGGAACATGAATCTGACAATAAACCCGTATTCCACACTCTCACCAATGGCCACCACCATAAGGGCAAACTCTCCGGGGATGAGGGCTCTGAGGATGGAGATGACTTTGATACCCCTCCAATACTTAAAGAACTGCAGTCCCTCAATACGGAGGAGGCAGCTGAGCAAAGGGCAGAAGTGGACAGAATGTTGAGCGAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAACATTTAAACAAAGGAACACCAATGAAGACCCAAAAACGTGCTGCATTGTACACTTGGTATGTGAGGAAACAAAGGGAGATAGTAATACAATTCAACCAGACAGTCCAGGGTTCTGGAAATATTACAGACAAAAGCAGTCAGGATCAGCTGCTGTTTCTCTTTCCAGAGTTTAATCAGCAAAATCCAGTCCCAGGACAGCCTGACGATTCCTGCTCAGAGCCTGCCAACAAGAAGATGAGACGAAATCGTTTCAAGTGGGGGCCTGCATCACAGCATATTCTTTACCAAGCCTATGAAAGGCAAAAGAATCCCAGCAAAGAAGAAAGAGAAGCTTTAGTGGAAGAGTGTAATAGAGCGGAATGTATTCAACGTGGTGTATCTCCATCTAAAGCTCATGGCCTTGGATCAAATTTGGTAACAGAAGTCCGTGTTTATAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                  2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     5     4     5     3     5     3     5     2     6     3     5     2     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4
                                               BLH ATG     123     779                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN     123     123                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR     123     702                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG     123      50                                                                                                                                                                                                                                                                                                                                                             
                                                                       PREDICTED - Sp ---- 1e-056     XP_001179097.1 PREDICTED: similar to transcription factor 1, hepatic [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ==== 5e-058     BAE06491.1 transcription factor protein [Ciona intestinalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 2e-089     NP_001116920.1 HNF1 homeobox A [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 2e-090     NP_001025839.1 transcription factor 1, hepatic [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ==== 8e-133     NP_571955.3 HNF1 homeobox b [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 6e-147     NP_033356.2 transcription factor 2 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 5e-147     NP_000449.1 transcription factor 2 isoform a [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 9e-148     XP_852994.1 PREDICTED: similar to transcription factor 2 isoform a [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Bt ==== 7e-148     XP_615465.3 PREDICTED: hypothetical protein isoform 1 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 3e-172     NP_001080685.1 transcription factor 2 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7008901.5                                                                                                                                                                                                                                                                                                                                                                                     TGA------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2       bld Emb4 5g                IMAGE:4959359-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                            AGACTCTCTGCGGGGACGTTGTCTGTGAGCACAAGAGGAACAGGTGCTCTGGGACAAGGGGATTCCAGATCCCTCttttttttattactcccctgtcccctttccttctttttttccctTGAAAATGGTGTCCAAGCTATCGCCTTTGCAGCAGGAACTCCTCAATGCTCTCCTCAACTCTGGAGTAACCAAAGAGGATCTGATCCAGGCCTTGGACGATATGATTCCCAGCCCAAGCTTTGGGGTGAAGCTGGAAAACTTGCACATGTCCCCGGAACATGAATCTGACAATAAACCCGTATTCCACACTCTCACCAATGGCCACCACCATAAGGGCAAACTCTCCGGGGATGAGGGCTCTGAGGATGGAGATGACTTTGATACCCCTCCAATACTTAAAGAACTGCAGTCCCTCAATACGGAGGAGGCAGCTGAGCAAAGGGCAGAAGTGGACAGAATGTTGAGCGAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAACATTTAAACAAAGGAACACCAATGAAGACCCAAAAACGTGCTGCCATTGTACACTTGGTATGTGAGGAAACAAAGGGAGATAGTAAATACCATTTCAACCAGACAGTCCCAGGGT
  5   1   2       bld Emb4 5g3  out                   IMAGE:4959359.5p                                                                                                                                                                                                                                                                                                                                                             GACTCTCTGCGGGGACGTTGTCTGTGAGCACAAGAGGAACAGGTGCTCTGGGACAAGGGGATTCCAGATCCCTCttttttttattactcccctgtcccctttccttctttttttccctTGAAAATGGTGTCCAAGCTATCGCCTTTGCAGCAGGAACTCCTCAATGCTCTCCTCAACTCTGGAGTAACCAAAGAGGATCTGATCCAGGCCTTGGTTTATATGATTCCCAGCCCAAGCTTTGGGGTGAAGCTGGAAAACTTGCACATGTCCCCGGAACATGAATCTGACAATAAACCCGTATTCCACACTCTCACCAATGGCCACCACCATAAGGGCAAACTCTCCGGGGATGAGGGCTCTGAGGATGGAGATGACTTTGATACCCCTCCAATACTTAAAGAACTGCAGTCCCTCAATACGGAGGAGGCAGCTGAGCAAAGGGCAGAAGTGGACAGAATGTTGAGCGAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAC
  5   1   2      seed Kid  5g                         IMAGE:7008901.5p                                                                                                                                                                                                                                                                                                                                                               CTCTCTGCGGGGACGTTGTCTGTGAGCACAAGAGGAACAGGTGCTCTGGGACAAGGGGATTCCAGATCCCTCttttttttattactcccctgtcccctttccttctttttttccctTGAAAATGGTGTCCAAGCTATCGCCTTTGCAGCAGGAACTCCTCAATGCTCTCCTCAACTCTGGAGTAACCAAAGAGGATCTGATCCAGGCCTTGGACGATATGATTCCCAGCCCAAGCTTTGGGGTGAAGCTGGAAAACTTGCACATGTCCCCGGAACATGAATCTGACAATAAACCCGTATTCCACACTCTCACCAATGGCCACCACCATAAGGGCAAACTCTCCGGGGATGAGGGCTCTGAGGATGGAGATGACTTTGATACCCCTCCAATACTTAAAGAACTGCAGTCCCTCAATACGGAGGAGGCAGCTGAGCAAAGGGCAGAAGTGGACAGAATGTTGAGCGAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAACATTTAAACAAAGGAACACCAATGAAGACCCAAAAACGTGCTGCATTGTACACTTGGTATGTGAGGAAACAAGGGAGATAGTAATACAATTCAACCAGACAGTCCAGGGTTCTGGAAATATTACAGACAAAAGCAGTCAGGATCAGCTGCTGTTTCTCTTTTCAGAGTTTTATCAGCAAAATCAGT
  5   1   2       bld Kid                             IMAGE:7011184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAGGGAAAGCTCTTGGGGCAGACTGCGCTGGGTGACAGCAGCAACATTATTCACGATTTATTGGTCTCTGCTCGTTTTTATTCCGATATCTGGTTGCAGGTCGAGCCTAGTCTTTTCCACTCCTATAAACAAGCGAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAACATTTAAACAAAGGAACACCAATGAAGACCCAAAAACGTGCTGCATTGTACACTTGGTATGTGAGGAAACAAAGGGAGATAGTAATACAATTCAACCAGACAGTCCAGGGTTCTGGAAATATTACAGACAAAAGCAGTCAGGATCAGCTGCTGTTTCTCTTTCCAGAGTTTAATCAGCAAAATCCAGTCCCAGGACAGCCTGACGATTCCTGCTCAGAGCCTGCCAACAAGAAGATGAGACGAAATCGTTTCAAGTGGGGGCCTGCATCACAGCATATTCTTTACCAAGCCTATGAAAGGCAAAAGAATCCCAGCAAGGAAGAAAGAGAAGCTTTAGTGGAAGAGTGTAATAGAGCGGAATGTATTCAACGTGGTGTATCTCCATCTAAAGCTCATGGCCTTGGATCAATTTGGTACAGAAGTCCGTGTTTAAATTGGTTGCAACAGAAGAAAAGGAACTTTTAGACAAATTGCTATGGATGCTATATACTGGCCACCACCCCACACN
  5   1   2       bld DMZ       out                        xl250p09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTTTGATACCCCTCCAATACTTAAAGAACTGCAGTCCCTCAATACGGAGGAGGCAGCTGAGCAAAGGGCAGAAGTGGACAGAATGTTGAGCGAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAACATTTAAACAAAGGAACACCAATGAAGACCCAAAAACGTGCTGCATTGTACACTTGGTATGTGAGGAAACANAGGGAGATAGTAATACAATTCAACCAGACAGTCCAGGGTTCTGGAAATATTACAGACNAAAGCAGTCAGGATCAGCTGCTGTTTCTCTTTCCAGAGTTTAATCAGCAAAATCCAGTCCCAGGACAGCCTGACGATTCCTGCTCAGAGCCTGCCAACAAGAAGATGAGACGAAATCGTTTCAAGTGGGGGCCTGCATCACAGCATATTCTTTACCAAGCCTATGAAAGGCAAAAGAATCCCAGCAAAGAAGAAAGAGAAGCTTTAGTGGAAGAGTGTAATAGAGCGGAATGTATTCAACGTGGTGTATCTCCATCTAAAGCTCATGGCCTTGGATCAAATTTGGTAACAGAAGTCCGTGTTTATAATTGGTTTGCAAACAGAA
  5   1   2       bld Kid                             IMAGE:7008552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGATCCATGGAGGGCTGCAAAAATGATAAAGGGTTATATGCAACAACACAATATTCCTCAGAGAGAAGTGGTGGATATCACTGGCTTAAACCAGTCCCATCTCTCCCAACATTTAAACAAAGGAACACCAATGAAGACCCAAAAACGTGCTGCATTGTACACTTGGTATGTGAGGAAACAAAGGGAGATAGTAATACAGTTTAATCAGCAAAATTCAGTCCCAGGACAGCCTGACGATTCCTGCTCAGAGCCTGCCAACAAGAAGATGAGACGAAATCGTTTCAAGTGGGGGCCTGCATCACAGCATATTCTTTACCAAGCCTATGAAAGGCAAAAGAATCCCAGCAAAGAAGAAAGAGAAGCTTTAGTGGAAGAGTGTAATAGAGCGGAATGTATTCAACGTGGTGTATCTCCATCTAAAGCTCATGGCCTTGGATCAAATTTGGTAACAGAAGTCCGTGTTTATAATTGGTTTGCAAACAGAAGGAAAGAGGAAGCTTTTAGACAAAAATTGGCTATGGATGCCTATAGTACTGGCCCATCACACCCCCACAACTTGAATTCTCTACTATCACATGGATCACCACACCATACTCAACCAAGCACTTCTCCACCAAGTAAACTGCAAGGGATGAGATATAATCAACAAGGAAACAATGAAGTCACTTCATCATCAACTATCAGTCACCATGGCAATAATGCCATGGN
  5   1   1       add Tbd7      out                        XL061f09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGACAGTCCAGGGGTTCTGAAAATATCACAGACAAAAGCAGTCAGGATCAGCTGCTGTTTCTCTTTCCAGAGTTTAATCAGCAAAATCAAGTTCAAGGACAGCCTGATGATACCTGCTCAGAGCCTTCCAACAAGAAGATGAGACGAAATCGTTTCAAATGGGGGCCTGCATCACAGCATATTCTTTATCAAGCCTATGAAAGGCAAAAGAATCCCAGCAAAGAAGAAAGAGAAGCTTTAGTGGAAGAATGTAACAGAGCGGAATGTCTTCAGCGTGGTGTATCTCCATCTAAAGCTCATGGCCTTGGATCAAATTTGGTAACAGAAGTCCGTGTTTATAACTGGTTTGCAAACAGAAGGAAAGAAGAGGCTTTTCGACAAAAACTGGCTATGGATGCCTATAGTACTGGCCCATCACACCCCCACAACTTGAATTCTCTACTATCACATGGATCACCACACCATACACAACCAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)