Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL146o07.3                            3 END     2          33       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8320355.5                       5 PI      74         56      514                paired-like homeobox 2a [Xenopus laevis]
     3   0.0    0Xl3.1-XL083l22.5                            2 PI      91        414      648                paired-like homeobox 2b [Xenopus laevis]

 This cluster: approximate FL confidence score = 72%

 1012785052 Xl3.1-xl258f18.5 - 6 ESTs
                                                                       ......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl258f18.5                                                                                                                                                                       CAGCTCCTCCAATATCTGCAGCCACCTCCAGGGTGACACTTCTAGAGCCTCTTCAATGTATAAAATGGAATATTCTTACCTCAATTCCTCCGCCTATGAGTCCTGCATGGCTGGCATGGACACTTCTAGTCTGGCCTCAGCCTATGCTGATTTCAGCTCATGCAGCCAAGCCAGCGGCTTCCAGTATAATCCTATCAGGACCACTTTTGGGGCCACTTCTGGCTGCCCATCCCTCACCCCCGGATCCTGCAGCTTTGGCACTCTCAGAGACCATCAGAGCAGCCCCTATGCAGCAGTTCCTTACAAGCTATTCACTGATCACGGTGGGCTGAATGAGAAGAGGAAACAGAGAAGGATACGCACAACCTTCACCAGCGCACAACTCAAGGAACTGGAGAGGGTATTCGCAGAGACCCATTACCCTGATATCTACACCCGTGAAGAACTGGCACTCAAGATAGACCTGACCGAAGCCAGAGTGCAGGTCTGGTTCCAGAACCGCAGGGCCAAATTCAGGAAGATGGAAAGAGCAGCAGCGGCGGCGGCGGCAGCAGCTAAGAACGGTTCCTCGGGCAAGAAATCCGACTCCTCGCGGGACGAAGAGAACAAGGACTCCAAGAGCGCTGATCCTGACAGCACTGGGGGGCC
                                                  Xl3.1-CHK-1012703189                                                                                                                                                                             CTCCAATATCTGCAGCCACCTCCAGGGTGACACTTCTAGAGCCTCTTCAATGTATAAAATGGAATATTCTTACCTCAATTCCTCCGCCTATGAGTCCTGCATGGCTGGCATGGACACTTCTAGTCTGGCCTCAGCCTATGCTGATTTCAGCTCATGCAGCCAAGCCAGCGGCTTCCAGTATAATCCTATCAGGACCACTTTTGGGGCCACTTCTGGCTGCCCATCCCTCACCCCCGGATCCTGCAGCxTxGGCACTCTCAGAGACCATCAGAGCAGCCCCTATGCAGCAGTTCCTTACAAGCTATTCACTGATCACGGTGGGCTGAATGAGAAGAGGAAACAGAGAAGGATACGCACAACCTTCACCAGCGCACAACTCAAGGAACTGGAGAGGGTATTCGCAGAGACCCATTACCCTGATATCTACACCCGTGAAGAACTGGCACTCAAGATAGACCTGACCGAAGCCAGAGTGCAGGTCTGGTTCCAGAACCGCAGGGCCAAATTCAGGAAGATGGAAAGAGCAGCAGCGGCGGCGGCGGCAGCAGCTAAGAACGGTTCCTCGGGCAAGAAATCCGACTCCTCGCGGGACGAAGAGAACAAGGACTCCAAGAGCGCTGATCCTGACAGCACTGG
                                                      consensus depths                                                                                                                                                                            2     4     2     5     3     5     3     5     3     5     3     5     3     5     4     5     4     5     5     5     5     5     4     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG      55     158                                                                                                                                                                       
                                               BLH MIN      55     109                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 7e-027     NP_001097075.1 CG34340 CG34340-PD [Drosophila melanogaster] --------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PROTEIN --- Ce ---- 3e-027     NP_491393.1 C.Elegans Homeobox (26.7 kD) (ceh-17) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                             PREDICTED = Sp ==== 3e-031     XP_001189037.1 PREDICTED: similar to paired-like homeobox 2b [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Ci ==== 4e-038     NP_001037829.1 homeodomain protein Phox2 [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                             PREDICTED = Bt ==== 1e-065     XP_584327.2 PREDICTED: similar to paired-like homeobox 2a [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 2e-098     XP_001252231.2 PREDICTED: similar to Paired mesoderm homeobox protein 2B (Paired-like homeobox 2B) (PHOX2B homeodomain protein) (Neuroblastoma Phox) (NBPhox) [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 1e-102     NP_001014818.1 paired-like homeobox 2b [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PREDICTED = Gg ==== 2e-106     XP_001234151.1 PREDICTED: similar to NBPhox [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 2e-107     XP_852840.1 PREDICTED: similar to Paired mesoderm homeobox protein 2B (Paired-like homeobox 2B) (PHOX2B homeodomain protein) (Neuroblastoma Phox) (NBPhox) [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 2e-107     NP_003915.2 paired-like homeobox 2b; neuroblastoma paired-type homeobox protein; pairedmesoderm homeobox 2b; PHOX2B homeodomain protein [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 1e-107     NP_032914.1 paired-like homeobox 2b; paired mesoderm homeobox 2b; dilated pupils 1; GENA 269[Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 5e-109     NP_001116492.1 paired-like homeobox 2b [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PREDICTED = Xl ==== 6e-111     NP_001088286.1 hypothetical protein LOC495120 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl258f18.5                                                                                                                                                                                                                              ATG------ATG---------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5  -1   2       bld Ga18      out                     xlk130p13ex.5p TTCGTGACTTTCAAGGGGACAGAAAGCTCCTGTCCAGTCGACAAATCAACATATATCCATATCACATGAATATTGGTTGGGATCATCAGAACACTATACACCTGTTTTATTGGTACGTCGGCTCAGTATGCAGCAGGAGGGTATCTTGGAATGGAGCAGGGAGTTGGNNCNNCGCCTCAGCAGGTGGAGGAGAGTGCCCTGACCATGGTGCTGAATTGTGCCAGTCCCTCTGCCATCACATGTGCCTCAATTCCTCCGCCTATGAGTCGTGCATGGCTGGCATGGACACTTCTAGCCTGNCCTCANCCTATGCCGATTTCAGCTCGTGCANNCNNNNAGTGGCTTCCAGTATAATCCTATCAGGACCACTTTTGGGGCCACTTCAGGTTGCCCNTCCCTCACCCCAGGATCCTGNANCTCGGCACTCTCAGAGACCATCAGAGCAGNCCCTATGCAGCAGGTAAGGANCCTCTTCCAAA
  5   1   2       bld Emb1 5g                         IMAGE:6863610.5p                                                                                                                                   ACACAGCAGAGCACATCTCCTACCAGAGCCTTCAGCCTCAGCTCCTCCAATATCTGCAGCCACCTCCAGGGTGACACTTCTAGAGCCTCTTCAATGTATAAAATGGAATATTCTTACCTCAATTCCTCCGCCTATGATCCTGCATGGTGGCATGGACACTTCTAGTCTGGCCTCAGCCTATGCTGATTTCAGCTCATGCAGCCAAGCCAGCGGCTTCCAGTATAATCCTATCAGGACCACTTTTGGGGCCACTTCTGGCTGCCCATCCCTCACCCCCGGATCCTGCAGCTTTGGCACTCTCAGAGACCATCAGAGCAGCCCCTATGCAGCAGTTCCTTACAAGCTATTCACTGATCACGGTGGGCTGAATGAGAAGAGGAAACAGAGAAGGATACGCACAACCTTCACCAGCGCACAACTCAAGGAACTGGAGAGGGTATTCGCAGAGACCCATTACCCTGATATCTACACCCGTGAAGAACTGGCACTCAAGATAGACCTGACCGAAGCCAGAGTGCAGGTCTGGTTCCAGAACCGCAGGGCCAAATTCANGAAGATGGAAAGAGCAACAGCGGCGGCGGCGGCAGCAGCTAAGAACGGTTCCTCGGGCAAGAAAATCCGACTCCTCGCGGGACGAAAGAGACAAGGAACTCCAAGAGCGCTGATCCTGACAGCACTggggggggCCTGGGAAACAACCCAAAACCCCACCTTCCAACTTGTGGTGGAAGGGCCCAAGTCCCTAGCCGGGGGCACAGGGGAAAATGGGGGTCCCACCAGGAACCCACGGCAAAGTTTCGGGGTTGCCAGGGGGCCCCTGGAAAACTTTGGCCATTCAACATCCAGTTTGTGGGGAACCTTACCGGTTGGGATCAACAAGGGCTGGGGCCAAACTGGGACCCGGGAAGGGCCCCCT
  5   1   2      seed DMZ       in                         xl258f18.5p                                                                                                                                      GCAGAGCACATCTCCTACCAGAGCCTTCAGCCTCAGCTCCTCCAATATCTGCAGCCACCTCCAGGGTGACACTTCTAGAGCCTCTTCAATGTATAAAATGGAATATTCTTACCTCAATTCCTCCGCCTATGAGTCCTGCATGGCTGGCATGGACACTTCTAGTCTGGCCTCAGCCTATGCTGATTTCAGCTCATGCAGCCAAGCCAGCGGCTTCCAGTATAATCCTATCAGGACCACTTTTGGGGCCACTTCTGGCTGCCCATCCCTCGCCCCCGGATCCTGCAGCCTCGGCACTCTCAGAGACCATCAGAGCAGCCCCTATGCAGCAGTTCCTTACAAGCTATTCACTGATCACGGTGGGCTGAATGAGAAGAGGAAACAGAGAAGGATACGCACAACCTTCACCAGCGCACAACTCAAGGAACTGGAGAGGGTATTCGCAGAGACCCATTACCCTGATATCTACACCCGTGAAGAACTGGCACTCAAGATAGACCTGACCGAAGCCAGAGTGCAGGTCTGGTTCCAGAACCGCAGGGCCAAATTCAGGAAGATGGAAAGAGCAGCAGCGGCGGCGGCGGCAGCAGCTAAGAACGGTTCCTCGGGCAAGAAATCCGACTCCTCGCGGGACGAAGAGAACAAGGACTCCAAGAGCGCTGATCCTGACAGCACTGGGGGGCCTGGA
  5   1   2       bld Ga12 5x3  out                        XL146o07.5p                                                                                                                                                                  AGCCTCAGCTCCTCCAATATCTGCAGCCACCTCCAGGGTGACACTTCTAGAGCCTCTTCAATGTATAAAATGGAATATTCTTACCTCAATTCCTCCGCCTATGAGTCCTGCATGGCTGGCATGGACACTTCTAGTCTGGCCTCAGCCTATGCTGATTTCAGCTCATGCAGCCAAGCCAGCGGCTTCCAGTATAATCCTATCAGGACCACTTTTGGGGCCACTTCTGGCTGCCCATCCCTCACCCCCGGATCCTGTAGCTTTGGCACTCTCAGAGACCATCAGAGCAGCCCCTATGCAGCAGTTCCTTACAAGCTATTCACTGATCACGGTGGGCTGAATGAGAAGAGGAAACAGAGAAGGATACGCACAACCTTCACCAGCGCACAACTCAAGGAACTGGAGAGGGTATTCGCAGAGACCCATTACCCTGATATCTACACCCGTGAAGAACTGGCACTCAAGATAGACCTGACCGAAGCCAGAGTGCAGGTCTGGTTCCAGAACCGCAGGGCCAAATTCAGGAAGATGGAAAGAGCAGCAGCGGCGGCGGCGGCAGCAGCTAAGAACGGTTCCTCGGGCAAGAA
  5   1   2       bld Ga12 5x3  out                        XL159f08.5p                                                                                                                                                                         CAGCTCCTCCATATCTGCAGCCCCTCCAGGGTGACACTTCTAGAGCCTCTTCAATGTATAAAATGGAATATTCTTACCTCAATTCCTCCGCCTATGAGTCCTGCATGGCTGGCATGGACACTTCTAGTCTGGCCTCAGCCTATGCTGATTTCAGCTCATGCAGCCAAGCCAGCGGCTTCCAGTATAATCCTATCAGGACCACTTTTGGGGCCACTTCTGGCTGCCCATCCCTCGCCCCCGGATCCTGCAGCCTCGGCACTCTCAGAGACCATCAGAGCAGCCCCTATGCAGCAGTTCCTTACAAGCTATTCACTGATCACGGTGGGCTGAATGAGAAGAGGAAACAGAGAAGGATACGCACAACCTTCACCAGCGCACAACTCAAGGAACTGGAGAGGGTATTCGCAGAGACCCATTACCCTGATATCTACACCCGTGAAGAACTGGCACTCAAGATAGACCTGACCGAAGCCAGAGTGCAGGTCTGGTTCCAG
  3   1   2       bld DMZ       in                         xl258f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTACACCCGTGAAGAACTGGCACTCAAGATAGACCTGACCGAAGCCAGAGTGCAGGTCTGGTTCCAGAACCGCAGGGCCAAATTCAGGAAGATGGAAAGAGCAGCAGCGGCGGCGGCGGCAGCAGCTAAGAACGGTTCCTCGGGCAAGAAATCCGACTCCTCGCGGGACGAAGAGAACAAGGACTCCAAGAGCGCTGATCCTGACAGCACTGGGGGGCCTGGAAACAACCCAAACCCCACTTCCAGCTGTGGTGGAGGGCCAAGTCCTAGCGGGGCACAGGGAAATGGGGTCCCACAGGAGCCAGGCAAGGTCGGGGTGCAGGGGCCTGGAAGCTTGGCATCAGCATCAGTTGTGGGACCTACAGGTGGATCACAAGGCTGGGCAACTGGACCAGGAGGCACCATCACCTCCATCCCTGACTCCTTAGGTGGTCCCTTCGCCAGTGTCTTATCTTCTCTGCAGAGACCCAACAGCGTCAAAGCCACTCTAGTCAAGAGCATGTTCTGAACTCTACTCCAGCCTTATCCTTCTACATAACACTACTATTCCTCTTAGGTACCTGGGCCTTGCTCTTGTGCTTCATGAGAAACAGAACTCTGAGAGTAACATTGATAAGGGCCAGGGCTGCCTGCAACCTTTCTGGTGAGATGGACCCTCAACATCAATTCTCCTCAAAGCAGTGAAACTAAGGGCCACATAAAGGAAGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)