Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 84%

 1012785106 Xl3.1-IMAGE:5084002.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5084002.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACATCCCAAGGAGAGCGATACAGAAAGAGAGAGAGGAGTCATTCCATACGCGCTGCCGGGACACACACAGAGTGAGAGAGAGAGAGAGCGAGGGGACAGCGCACACTGATACGATGGACAAGTTACTGGCTGCCCTGTGCTTGCTGGGAATGTGCTGCTCGCTGGCTGTAACGGATGTGAGCGTGAGATCCTCACCGTTGGATCTAGAAGCATCAGGAGACGATGAGGACTTCTCTGGCTCAGGAATTGATGATCTAGATGTAGACCATGTAGTTCCTTCTACATCTGCGTTGCCTTCTGTGTTGTCTGCTGTGCCCAATTTTGTGCAAGAAAATACATCACCAAATGCCAAGGTAGATGAAAAGGATACTGCAGCAGAGCATACCACCAGAGTAGTGGAGACAACTAAGCCAAGTGAAGATCCTGTTGAGGAATTGGTTGAACCTGTTTTTGTTGGTGTAGGACATGATGCTGAATCAACTTCTCCTGAAGCAACCACACACAAACCTACTACTCACCGTCCAACCACTGTGAAATCCACAGCTGGCCCAATGGAAAGTATCACAGAACAAAACCATCACCCTCATCATCATCACCACCACCATCATCATCATCACCACCAAAATCATACAACCACAGCTAAACCAACTTCTGCCACTGATCAACATGTAGATAACTCTGATAGTCCATCGGGTGAGGATAAGTCTTACATTCACCACAAAGTAACAACTACAAGTCCAATAGATAATGAGGAACCTGATCTGCATGAGGCTGACCATAGGTTGACCACCATAAAAACAAGGAACACGGGAGGACTAATTAATCATCACGTTCCTGATCAAGACTCTCCATCTGGATCGTCTAGTACCCCTTATATGGAATTTGAGGGAGACAACTGAAAGATCCTTTCCGGTGGCTCCAGTACATAAATGTGGCTTTATTGGGG
                                                  Xl3.1-CHK-1012708859                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAAGGAGAGCGATACAGAAAGAGAGAGAGGAGTCATTCCATACGCGCTGCCGGGACACACACAGAGTGAGAGAGAGAGAGAGCGAGGGGACAGCGCACACTGATACGATGGACAAGTTACTGGCTGCCCTGTGCTTGCTGGGAATGTGCTGCTCGCTGGCTGTAACGGATGTGAGCGTGAGATCCTCACCGTTGGATCTAGAAGCATCAGGAGACGATGAGGACTTCTCTGGCTCAGGAATTGATGATCTAGATGTAGACCATGTAGTTCCTTCTACATCTGCGTTGCCTTCTGTGTTGTCTGCTGTGCCCAATTTTGTGCAAGAAAATACATCACCAAATGCCAAGGTAGATGAAAAGGATACTGCAGCAGAGCATACCACCAGAGTAGTGGAGACAACTAAGCCAAGTGAAGATCCTGTTGAGGAATTGGTTGAACCTGTTTTTGTTGGTGTAGGACATGATGCTGAATCAACTTCTCCTGAAGCAACCACACACAAACCTACTACTCACCGTCCAACCACTGTGAAATCCACAGCTGGCCCAATGGAAAGTATCACAGAACAAAACCATCACCCTCATCATCATCACCACCACCATCATCATCATCACCACCAAAATCATACAACCACAGCTAAACCAACTTCTGCCACTGATCAACATGTAGATAACTCTGATAGTCCATCGGGTGAGGATAAGTCTTACATTCACCACAAAGTAACAACTACAAGTCCAATAGATAATGAGGAACCTGATCTGCATGAGGCTGACCATAGGTTGACCACCATAAAAACAAGGAACACGGGAGGACTAATTAATCATCACGTTCCTGATCAAGACTCTCCATCTGGATCGTCTAGTACCCCTTATATGGAATTTGAGGGAGACAACTGAAAGATCCTTTCCGGTGGCTCCAGTACATAAATGTGGCTTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     4     2     4     2     4     1     3     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     115     300                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     115      21                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bt ---- 3e-007     NP_001069392.1 syndecan 1 [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-007     NP_995676.2 CG33300-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 6e-008     XP_641903.1 hypothetical protein DDBDRAFT_0220593 [Dictyostelium discoideum AX4] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ag ---- 2e-008     XP_001689176.1 AGAP010030-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 3e-009     NP_571919.1 v-maf musculoaponeurotic fibrosarcoma (avian) oncogene homolog [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 7e-010     NP_001006947.1 syndecan 1 precursor [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 1e-147     AAB81324.1 syndecan-1 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5084002.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TGA---------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Oo1  5g                         IMAGE:6861154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACATCCCAAGGAGAGCGATACAGAAAGAGAGAGAGGAGTCATTCCATACGCGCTGCCGGGACACACACagagtgagagagagagagagCGAGGGGACAGCGCACACTGATACGATGGACAAGTTACTGGCTGCCCTGTGCTTGCTGGGAATGTGCTGCTCGCTGGCTGTAACGGATGTGAGCGTGAGATCCTCACCGTTGGATCTAGAAGCATCAGGAGACGATGAGGACTTCTCTGGCTCAGGAATTGATGATCTAGATGTAGACCATGTAGTTCCTTCTACATCTGCGTTGCCTTCTGTGTTGTCTGCTGTGCCCAATTTTGTGCAAGAAAATACATCACCAAATGCCAAGGTAGATGAAAAGGATACTGCAGCAGAGCATACCACCAGAGTAGTGGAGACAACTAAGCCAAGTGAAGATCCTGTTGAGGAATTGGTTGAACCTGTTTTTGTTGGTGTAGGACATGATGCTGAATCAACTTCTCCTGAAGCAACCACACACAAACCTACTACTCACCGTCCAACCACTGTGAAATCCACAGCTGGCCCAATGGAAAGTATCACAGAACaaaaccatcaccctcatcatcatcaccaccaccatcatcatcatcaccaccaaaatcatACAACCACAGCTAAACCAACTTCTGCCACTGATCAACATGTAGATAACTCTGATAGTCCCATCGGTGAAGATAAGTCTTACATTTCCCCACCAAGTAACAACTACCAATTCCAATAGACCAATGAGGAACCTGATCTGCATGAAGCTGAACCATAGGTTTGACCACCTTAA
  5   1   2       bld Oo1  5x3                        IMAGE:5084002.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACACagagtgagagagagagagagCGAGGGGACAGCGCACACTGATACGATGGACAAGTTACTGGCTGCCCTGTGCTTGCTGGGAATGTGCTGCTCGCTGGCTGTAACGGATGTGAGCGTGAGATCCTCACCGTTGGATCTAGAAGCATCAGGAGACGATGAGGACTTCTCTGGCTCAGGAATTGATGATCTAGATGTAGACCATGTAGTTCCTTCTACATCTGCGTTGCCTTCTGTGTTGTCTGCTGTGCCCAATTTTGTGCAAGAAAATACATCACCAAATGCCAAGGTAGATGAAAAGGATACTGCAGCAGAGCATACCACCAGAGTAGTGGAGACAACTAAGCCAAGTGAAGATCCTGTTGAGGAATTGGTTGAACCTGTTTTTGTTGGTGTAGGACATGATGCTGAATCAACTTCTCCTGAAGCAACCACACACAAACCTACTACTCACCGTCCAACCACTGTGAAATCCACAGCTGGCCCAATGGAAAGTATCACAGAACaaaaccatcaccctcatcatcatcaccaccaccatcatcatcatcaccaccaaaatcatACAACCACAGCTAAACCAACTTCTGCCACTGATCAACATGTAGATAACTCTGATAGTCCATCGGGTGAGGATAAGTCTTACATTCACCACAAAGTAACAACTACAAGTCCAATAGATAATGAGGAACCTGATCTGCATGAGGCTGACCATAGGTTGACCACCATAAAAACAAGGAACACGGGAGGACTAATTAATCATCACGTTCCTGATCAAGACTCTCCATCTGGATCGTCTAGTACCCCTTATATGGAATTTGAGGGAGACAACTGAAAGATCCTTTCCGGTGGCTCCAGTACATAAATGTGGCTTTATTGGGGCC
  5   1   2      seed Ga12 5g                              XL201c03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTgagagagagagagagagCGAGGGGACAGCGCACACTGATACGATGGACAAGTTACTGGCTGCCCTGTGCTTGCTGGGAATGTGCTGCTCGCTGGCTGTAACGGATGTGAGCGTGAGATCCTCACCGTTGGATCTAGAAGCATCAGGAGACGATGAGGACTTCTCTGGCTCAGGAATTGATGATCTAGATGTAGACCATGTAGTTCCTTCTACATCTGCGTTGCCTTCTGTGTTGTCTGCTGTGCCCAATTTTGTGCAAGAAAATACATCACCAAATGCCAAGGTAGATGAAAAGGATACTGCAGCAGAGCATACCACCAGAGTAGTGGAGACAACTAAGCCAAGTGAAGATCCTGTTGAGGAATTGGTTGAACCTGTTTTTGTTGGTGTAGGACATGATGCTGAATCAACTTCTCCTGAAGCAACCACACACAAACCTACTACTCACCGTCCAACCACTGTGAAATCCACAGCTGGCCCAATGGAAAGTATCACAGAACAAAaccatcaccctcatcatcatcaccaccatcatcatcatcaccaccaaaatcatACAACCACAGCTAAACCAACTTCTGCCACTGATCAACATGTAGATAACTCTGATAGTCCA
  5   1   2       bld Neu7 5g                              XL020j21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGACAGCGCACACTGATACGATGGACAAGTTACTGGCTGCCCTGTGCTTGCTGGGAATGTGCTGCTCGCTGGCTGTAACGGATGTGAGCGTGAGATCCTCACCGTTGGATCTAGAAGCATCAGGAGACGATGAGGACTTCTCTGGCTCAGGAATTGATGATCTAGATGTAGACCATGTAGTTCCTTCTACATCTGCGTTGCCTTCTGTGTTGTCTGCTGTGCCCAATTTTGTGCAAGAAAATACATCACCAAATGCCAAGGTAGATGAAAAGGATACTGCAGCAGAGCATACCACCAGAGTAGTGGAGACAACTAAGCCAAGTGAAGATCCTGTTGAGGAATTGGTTGAACCTGTTTTTGTTGGTGTAGGACATGATGCTGAATCAACTTCTCCTGAAGCAACCACACACAAACCTACTACTCACCGTCCAACCACTGTGAAATCCACAGCTGGCCCAATGGAAAGTATCACAGAACAAaaccatcaccctcatcatcaccaccaccatcatcatcatcaccaccaaaatcatACAACCACAGCTAAACCAACTTCTGCCACTGATCAACATGTAGATAACTCTGATAGTCCATCGGGTGAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)