Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012785108 Xl3.1-IMAGE:7207052.5 - 3 ESTs
                                                                       .....-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7207052.5                                                                                                TTGTGATTGAGCAGTTTCGGTAGGGATCCCGGGATCGCACAGAGACATTGCAATCTAGCGTAATCTTTCAGTTAAAGCAAATACACATAGAATGCAGCAACAAAAAGGGGAAGAAGTCTACTACGTGGGAATAGATGTGGGGACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACAGTGGTAGACCAAGTGGAACAGTCAATCAAAATATGGGAACCTCAGCCTGACCACTATGAGCAATCTTCTGATGACATCTGGGCTGCTTGTTGCCAGGTTACAAAGCAAGTTGTGCGTACCAAAGACCCTAGATGCATTCGAGGACTTGGATTTGATGCCACGTGTTCTTTAGTGGTACTTGACACACAGTTCCAACCACTGGCAGTGAATTCACAAGGTGAGCATAAGAGAAACATAATAATGTGGATGGACCATCGCGCTGGATGTCAAGTTGATCGTATAAATCGCACGAATCACAAGGTGTTGAGATATGTTGGTGGAGTTATGTCTGTTGAAATGCAGCCACCCAAGCTCCTTTGGTTAAAGGAAAACTTGCGAGAAGAGTGTTGGAATAAATCAGGGCAATTATTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACAACACAAGACAAGTCAGAGAAATGATGCAGGAGAGGTTGCAGATGTATTACTGGCATCCTGCCCACAACATTGGACTGGGAGCAAGGTTGGAGGATATTTGCGAGGGGAACTATGTAAAATAGGAAACCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCCACAGCTGCCAAAGAACTTGGTCTTCCAGAAGGACTTCCAGTGGCTGCTTCACTTATTGATGCCCATGCGGGGAGGTTTTAGGGTGTGATTTGGAGCCACGTCTGAAAGGAATATTGGCCCTAGAAAGGGGNAAAATCATTCCAATTCACATCCCAGGATTTAAGC
                                                  Xl3.1-CHK-1012714870                                                                                                      TTGAGCAGTTTCGGTAGGGATCCCGGGATCGCACAGAGACATTGCAATCTAGCGTAATCTTTCAGTTAAAGCAAATACACATAGAATGCAGCAACAAAAAGGGGAAGAAGTCTACTACGTGGGAATAGATGTGGGGACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACAGTGGTAGACCAAGTGGAACAGTCAATCAAAATATGGGAACCTCAGCCTGACCACTATGAGCAATCTTCTGATGACATCTGGGCTGCTTGTTGCCAGGTTACAAAGCAAGTTGTGCGTACCAAAGACCCTAGATGCATTCGAGGACTTGGATTTGATGCCACGTGTTCTTTAGTGGTACTTGACACACAGTTCCAACCACTGGCAGTGAATTCACAAGGTGAGCATAAGAGAAACATAATAATGTGGATGGACCATCGCGCTGGATGTCAAGTTGATCGTATAAATCGCACGAATCACAAGGTGTTGAGATATGTTGGTGGAGTTATGTCTGTTGAAATGCAGCCACCCAAGCTCCTTTGGTTAAAGGAAAACTTGCGAGAAGAGTGTTGGAATAAATCAGGGCAATTATTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACAACACAAGACAAGTCAGAGAAATGATGCAGGAGAGGTTGCAGATGTATTACTGGCATCCTGCCCACAACATTGGACTGGGxxxxxGGTTGGAGGATATTTGCGAGGGGAACTATGTAAAATAGGAAACCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCCACAGCTGCCAAAGAACTTGGTCTTCCAGAAGGACTTCCAGTGGCTGCTTCACTTATTGATGCCCATGCGGGGAGGTTTTAGGGTGTGATTTGGAGCCACGTCTGAAAGGAATATTGGCCCTAGAAAGGGGNAAAATCATTCCAATTCACATCCCAGGATTTAAGCCCCTGT
                                                      consensus depths                                                                                                     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      91     423                                                                                                
                                               BLH MIN      88      94                                                                                                
                                               BLH OVR      91     710                                                                                                
                                               ORF LNG      91      29                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ==== 1e-045     XP_613615.4 PREDICTED: similar to CG11594 CG11594-PA [Bos taurus] ==========================================================================================================================================================================
                                                                                                                                                                                                                                                     PREDICTED - At ---- 4e-052     NP_194760.2 ribitol kinase, putative [Arabidopsis thaliana] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN --- Ag ---- 4e-057     XP_315996.3 AGAP005956-PA [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN --- Dm ==== 2e-059     NP_728919.1 CG11594-PC, isoform C [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 5e-066     XP_001184243.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PREDICTED - Cf ---- 7e-082     XP_865634.1 PREDICTED: similar to CG11594-PA, isoform A isoform 4 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Hs ==== 3e-082     NP_001106882.1 FGGY carbohydrate kinase domain containing isoform a [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 1e-081     NP_001106883.1 FGGY carbohydrate kinase domain containing isoform a [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 8e-092     XP_001235529.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PREDICTED = Xt ==== 1e-120     NP_001120276.1 hypothetical protein LOC100145330 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 2e-132     Q6DCD1.2 FGGY carbohydrate kinase domain-containing protein [Xenopus laevis]  ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7207052.5                                                                                                       TGA---------------------------------------------TAG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------ATG---------------------------------------------------------------------------TAG------------------------------TAG---------TAA---------------------------------------------------------------ATG---ATG------------------TGA------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Te2       in                    IMAGE:7207052.5p                                                                                                TTGTGATTGAGCAGTTTCGGTAGGGATCCCGGGATCGCACAGAGACATTGCAATCTAGCGTAATCTTTCAGTTAAAGCAAATACACATAGAATGCAGCAACAAAAAGGGGAAGAAGTCTACTACGTGGGAATAGATGTGGGGACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACAGTGGTAGACCAAGTGGAACAGTCAATCAAAATATGGGAACCTCAGCCTGACCACTATGAGCAATCTTCTGATGACATCTGGGCTGCTTGTTGCCAGGTTACAAAGCAAGTTGTGCGTACCAAAGACCCTAGATGCATTCGAGGACTTGGATTTGATGCCACGTGTTCTTTAGTGGTACTTGACACACAGTTCCAACCACTGGCAGTGAATTCACAAGGTGAGCATAAGAGAAACATAATAATGTGGATGGACCATCGCGCTGGATGTCAAGTTGATCGTATAAATCGCACGAATCACAAGGTGTTGAGATATGTTGGTGGAGTTATGTCTGTTGAAATGCAGCCACCCAAGCTCCTTTGGTTAAAGGAAAACTTGCGAGAAGAGTGTTGGAATAAATCAGGGCAATTATTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACAACACAAGACAAGTCAGAGAAATGATGCANGAGAGGTTGCAGATGTATTACTGGCATCCTGCCCACAACATTGGACTGGGAGCAAGCATGAAGTCATCCTAACTGGAGTCCACTGAGCCACGCAATGTGTCTTCTTTGACAAGTAAGGCTACTGATAACTT
  3   1   2       bld Te2       in                    IMAGE:7207052.3p                                                                                                              TTCGTCCCGAAATCCCGGGATCGCACAGAGACATTGCAATCTAGCGTAATCTTTCAGTTAAAGCAAATACACATAGAATGCAGCAACAAAAAGGGGAAGAAGTCTACTACGTGGGAATAGATGTGGGGACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACAGTGGTAGACCAAGTGGAACAGTCAATCAAAATATGGGAACCTCAGCCTGACCACTATGAGCAATCTTCTGATGACATCTGGGCTGCTTGTTGCCAGGTTACAAAGCAAGTTGTGCGTACCAAAGACCCTAGATGCATTCGAGGACTTGGATTTGATGCCACGTGTTCTTTAGTGGTACTTGACACACAGTTCCAACCACTGGCAGTGAATTCACAAGGTGAGCATAAGAGAAACATAATAATGTGGATGGACCATCGCGCTGGATGTCAAGTTGATCGTATAAATCGCACGAATCACAAGGTGTTGAGATATGTTGGTGGAGTTATGTCTGTTGAAATGCAGCCACCCAAGCTCCTTTGGTTAAAGGAAAACTTGCGAGAAGAGTGTTGGAATAAATCAGGGCAATTATTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACAACACAAGACAAGTCAGAGAAATGATGCAGGAGAGGTTGCAGATGTATTACTGGCATCCTGCCACAAACATTGGACTGGGAGCCAAGCATGAAGTCATCCTACACTGGAGTCCAACTGAGCCACGGCAATGTGTCTTCATTGACAAAGTAAAGCCTACCTT
  5   1   2      seed Oo1  5g                         IMAGE:5084855.5p                                                                                                                                  ACGCACAGAGACATTGCAATCTAGCGTAATCTTTCAGTTAAAGCAAATACACATAGAATGCAGCAACAAAAAGGGGAAGAAGTCTACTACGTGGGAATAGATGTGGGGACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACAGTGGTAGACCAAGTGGAACAGTCAATCAAAATATGGGAACCTCAGCCTGACCACTATGAGCAATCTTCTGATGACATCTGGGCTGCTTGTTGCCAGGTTACAAAGCAAGTTGTGCGTACCAAAGACCCTAGATGCATTCGAGGACTTGGATTTGATGCCACGTGTTCTTTAGTGGTACTTGACACACAGTTCCAACCACTGGCAGTGAATTCACAAGGTGAGCATAAGAGAAACATAATAATGTGGATGGACCATCGCGCTGGATGTCAAGTTGATCGTATAAATCGCACGAATCACAAGGTGTTGAGATATGTTGGTGGAGTTATGTCTGTTGAAATGCAGCCACCCAAGCTCCTTTGGTTAAAGGAAAACTTGCGAGAAGAGTGTTGGAATAAATCAGGGCAATTATTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACAACACAAGATCATTTTGTACACTGGTATGCAAATGGACCTATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGCGAGGGGAACTATGTAAAATAGGAAACCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCCACAGCTGCCAAAGAACTTGGTCTTCCAGAAGGACTTCCAGTGGCTGCTTCACTTATTGATGCCCATGCGGGGAGGTTTTAGGGTGTGATTTGGAGCCACGTCTGAAAGGAATATTGGCCCTAGAAAGGGGNAAAATCATTCCAATTCACATCCCAGGATTTAAGCCCCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)