Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:8822142.3                       6 END     1          20       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8547882.5                       2 PI      93         36      588                novel ubiquitin-conjugating enzyme (ortholog of human NEDD8-conjugating enzyme NCE2) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012785249 Xl3.1-IMAGE:7009872.5 - 5 ESTs
                                                                       ......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7009872.5                 CCAATGACGCCTGGATTAGCTGTCCGGCAGGAGTTGAGGAGCTAGACCTTAACGGGGGCTGAGGGACTTTTAAATAGCGACCCAGAACTGCTGAGTGTGTTAAGAAAATCGGAAACGTCCCGGAAAAAGCGGGGCTTGTTGGGCGGTGGTGGGTAGCGTGATGCTTACATTGGCAAGCAAGCTGAAGCGGGATGATGGTGTTAAAGGAAGCCGAACTACTAGCACAACCTTGGATTCAATGCGCAGAATCTCTGTCCGCGACAGATTACTTGTGAAAGAAGTGGCGGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCTGACCCCAACAAGTTGCATTACTTCCATCTGACTGTGAGTCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAATATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACAGAGACAGGAGAAATTTGTTTAAGTTTGCTAAGGGAACATTCAATTGATGGAACGGGTTGGGCTCCGACAAGAACTTTAAAGGATGTTGTGTGGGGATT
                                                  Xl3.1-CHK-1012705969                       ACGCCTGGATTAGCTGTCCGGCAGGAGTTGAGGAGCTAGACCTTAACGGGGGCTGAGGGACTTTTAAATAGCGACCCAGAACTGCTGAGTGTGTTAAGAAAATCGGAAACGTCCCGGAAAAAGCGGGGCTTGTTGGGCGGTGGTGGGTAGCGTGATGCTTACATTGGCAAGCAAGCTGAAGCGGGATGATGGTGTTAAAGGAAGCCGAACTACTAGCACAACCTTGGATTCAATGCGCAGAATCTCTGTCCGCGACAGATTACTTGTGAAAGAAGTGGCGGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCTGACCCCAACAAGTTGCATTACTTCCATCTGACTGTGAGTCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAATATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACAGAGACAGGAGAAATTTGTTTAAGTTTGCTAAGGGAACATTCAATTGATGGAACGGGTTGGGCTCCGACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTC
                                                      consensus depths                      2     2     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4
                                               BLH ATG     152     592                 
                                               BLH MIN     146      89                 
                                               BLH OVR     152     953                 
                                               EST CLI     -40       1                 
                                               ORF LNG     152      22                 
  5   1   2       bld Kid  5g                         IMAGE:7009872.5p CCCACGCGTCCGGAGACCAATGACGCCTGGATTAGCTGTCCGGCAGGAGTTGAGGAGCTAGACCTTAACGGGGGCTGAGGGACTTTTAAATAGCGACCCAGAACTGCTGAGTGTGTTAAGAAAATCGGAAACGTCCCGGAAAAAGCGGGGCTTGTTGGGCGGTGGTGGGTAGCGTGATGCTTACATTGGCAAGCAAGCTGAAGCGGGATGATGGTGTTAAAGGAAGCCGAACTACTAGCACAACCTTGGATTCAATGCGCAGAATCTCTGTCCGCGACAGACTACTTGTGAAAGAAGTGGCGGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCTGACCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGTCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAATATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACAGAGACAGGAGAAATTTGTTTAAGTTTGCTAAGGGAACATTCAATTGATGGAACGGGTTGGGCTCCGACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATGTTGATGATCCTTTAACATTGAGGCTGCAAACATTCTTTGAGGGA
  5   1   2       bld Emb1 5g                         IMAGE:3401534.5p                 CCAATGACGCCTGGATTAGCTGTCCGGCAGGAGTTGAGGAGCTAGACCTTAACGGGGGCTGAGGGACTTTTAAATAGCGACCCAGAACTGCTGAGTGTGTTAAGAAAATCGGAAACGTCCCGGAAAAAGCGGGGCTTGTTGGGCGGTGGTGGGTAGCGTGATGCTTACATTGGCAAGCAAGCTGAAGCGGGATGATGGTGTTAAAGGAAGCCGAACTACTAGCACAACCTTGGATTCAATGCGCAGAATCTCTGTCCGCGACAGGTTACTTGTGAAAGAAGTGGCGGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCTGACCCCAACAAGTTGCATTACTTCCATCTGACTGTGAGTCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAATATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACAGAGACAGGAGAAATTTGTTTAAGTTTGCTAAGGGAACATTCAATTGATGGAACGGGTTGCGCTCCGACAAGAAACTTTAAGGATGTTGTGTGGGGATTGAACTCTCTNGATACAGATCTATTAAATTTTGATGATCCTTTAAACATT
  5   1   2       bld Te2N 5g                         IMAGE:7768348.5p                      GACGCCTGGATTAGCTGTCCGGCAGGAGTTGAGGAGCTAGACCTTAACGGGGGCTAAGGGACTTTTAAATAGCGACCCGGAACTGCTGAGTGTGTTAAGAAAATCGGAAACGTCCCGGAAAAAGCGGGGCTTGTTGGGCGGTGGTGGGTAGCGTGATGCTTACATTGGCAAGCAAGCTGAAGCGGGATGATGGTGTTAAAGGAAGCCGAACTACTAGCACAACCTTGGATTCAATGCGCAGAATCTCTGTCCGCGACAGGTTACTTGTGAAAGAAGTGGCGGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCTGACCCCAACAGTGCATTACTTCCATCTG
  5   1   2      seed Tbd7 5g3  out                        XL098p23.5p                                             GGGAGTTGAGGAGCTAGACCTTAACGGGGGCTAAGGGACTTTTAAATAGCGACCCGGAACTGCTGAGTGTGTTAAGAAAATCGGAAACGTCCCGGAAAAAGCGGGGCTTGTTGGGCGGTGGTGGGTAGCGTGATGCTTACATTGGCAAGCAAGCTGAAGCGGGATGATGGTGTTAAAGGAAGCCGAACTACTAGCACAACCTTGGATTCAATGCGCAGAATCTCTGTCCGCGACAGATTACTTGTGAAAGAAGTGGCGGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCTGACCCCAACAAGTTGCATTACTTCCATCTGACTGTGAGTCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAATATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACAGAGACAGGAGAAATTTGTTTAAGTTTGCTAAGGGAACATTCAATTGATGGAACGGGTTGGGCTCCGACAAGAACTTTAAAGGATGTTGTGTGGGGATTG
  5   1   2       bld DMZ  5g                              xl276j01.5p                                                          CTAGACCTTAACGGGGGCTGAGGGACTTTTAAATAGCGACCCAGAACTGCTGAGTGTGTTAAGAAAATCGGAAACGTCCCGGAAAAAGCGGGGCTTGTTGGGCGGTGGTGGGTAGCGTGATGCTTACATTGGCAAGCAAGCTGAAGCGGGATGATGGTGTTAAAGGAAGCCGAACTACTAGCACAACCTTGGATTCAATGCGCAGAATCTCTGTCCGCGACAGATTACTTGTGAAAGAAGTGGCGGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCTGACCCCAACAAGTTGCATTACTTCCATCTGACTGTGAGTCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAATATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACAGAGACAGGAGAAATTTGTTTAAGTTTGCTAAGGGAACATTCAATTGATGGAACGGGTTGGGCTCCGACAAGAACTTTAAAGGATGTTGTGGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGATCCTTTAAACATTGAGGCAGCAGAGCATCATTTGAGGGATAAGGATGAGTATCGGAATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)