Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6874317.3                      51 END     1          10        1                (no blast hit)
     2   2.0    0Xl3.1-xlk144m08ex.3                         5 END     1          10       20                (no blast hit)
     3   2.0    0Xl3.1-IMAGE:5073018.5                       3 END     1          10       33                hypothetical protein [Arabidopsis thaliana]

 This cluster: approximate FL confidence score = 0%

 1012785414 Xl3.1-IMAGE:5073018.3 - 10 ESTs
                                                                       .....-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5073018.3                                                                                                                                                                                          GCCCACTGGNACAACCCAGNACTCTAGGACGTTATTGGTCCATAAAGTATTCCCTGGATTTTCCATCAAAGCGTTTGACTATGAGAAGGCTTACAGTCTGCAGAGACCTAATGACCACGAGTTCATGCAACAACCATGGACCGGATTTACTGTACAGATAAGCTTCGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTTATCAGCAGTTGCCCGTGTTGGCTGGAGGTGATATTTAATAACCGGTGACTCGGACACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCCCGCGGACTTGTTTTTACGTTTTTTGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTTCTCATTCTGTTCTTGCCTGTGTGAATGACTTCAGGCCGAGCTTTGCCCCGGGTAGGGGACGGGTGCTTGGGCAACGCGTGGAGTGTGCTTGTAATGGGTTTTTTTGGGGGAGGGTATCGACCGCTTTCTTGTGCAATGAATAGAAGATATTTTTGTCTAGGGTGGGGGGTTAGGACTGGGCTGAATTCAGTATTTTTCTTTTGCATATGGGTGACCACTACTACGCCTCCCATCTCCTAAGTAAGGGCACGGCTGTATCAAGTATTCTAGTGGGCGACTTTAGAGCGACATCTAAGGTGTTTTTATTGGTTTATCCGTTGCAGGGATAACGGGAAAGGATGCTGATGCTGTTGCTAAGCAACGGCAAGGCCAATAATAATAATAAAGGCACCTTAGGTTGCTCTGCTACTATTTCTGCTGTCCTATAGCGAAACGAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACATGGATCACTCTCCAGGTCCGCTCCCGACCCAAGGTGTAAACATTATTGCGGAGTCTGATTTGCAGTGATCTGTTGTCCTATATCCCCGATAAAGACCAAACCCAAAAAAAAACTGCCATTCTGTTACCTGCCCCCCCCCCCCCCAAA
                                                  Xl3.1-CHK-1012696387                                                                                                                                                                                                TGGNACAACCCAGNACTCTAGGACGTTATTGGTCCATAAAGTATTCCCTGGATTTTCCATCAAAGCGTTTGACTATGAGAAGGCTTACAGTCTGCAGAGACCTAATGACCACGAGTTCATGCAACAACCATGGACCGGATTTACTGTACAGATAAGCTTCGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTTATCAGCAGTTGCCCGTGTTGGCTGGAGGTGATATTTAATAACCGGTGACTCGGACACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCCCGCGGACTTGTTTTTACGTTTTTTGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTTCTCATTCTGTTCTTGCCTGTGTGAATGACTTCAGGCCGAGCTTTGCCCCGGGTAGGGGACGGGTGCTTGGGCAACGCGTGGAGTGTGCTTGTAATGGGTTTTTTTGGGGGAGGGTATCGACCGCTTTCTTGTGCAATGAATAGAAGATATTTTTGTCTAGGGTGGGGGGTTAGGACTGGGCTGAATTCAGTATTTTTCTTTTGCATATGGGTGACCACTACTACGCCTCCCATCTCCTAAGTAAGGGCACGGCTGTATCAAGTATTCTAGTGGGCGACTTTAGAGCGACATCTAAGGTGTTTTTATTGGTTTATCCGTTGCAGGGATAACGGGAAAGGATGCTGATGCTGTTGCTAAGCAACGGCAAGGCCAATAATAATAATAAAGGCACCTTAGGTTGCTCTGCTACTATTTCTGCTGTCCTATAGCGAAACGAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACATGGATCACTCTCCAGGTCCGCTCCCGACCCAAGGTGTAAACATTATTGCGGAGTCTGATTTGCAGTGATCTGTTGTCCTATATCCCCGATAAAGACCAAACCCAAAAAAAAAxxxxxATTCTGTTACCTGCCCCCCCCCCCCCCAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                               2     3     2     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     4     5     5     5     5     5     4     5     4     5     5     5     5     5     5     5     5     6     5     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     2     5     2     5     3     3
                                               BLH MIN      22      39                                                                                                                                                                                          
  5   1   2       bld Li1                             IMAGE:3398216.5p GACGCGTGGGTCTTCTATGATCTACCTCAAGGGAACGGCTTCTGCCTTGGGCAGTTGAACTCGGACAATAAAAGTCAGCTGGTGCAGAAGGTCCGCAGCAAAATCGGCTACGGCATCCAGCTGACCAAGGAAGTGGACGGCGTCTGGGTCTACAACCGCAGCAGTTACCCCATCTTCATCAAGTCGGCCACACTGGACAACCCAGACTCTAGGACGTTATTGGTCCATAAAGTATTCCCTGGATTTTCCATCAAAGTGTTTGACTATGTGAAGGCTTACAGTCTGCAGAGACCTAATGACCACGAGTTCATGCAACAACCATGGACCGGATTTACTGTACAGATAAGCTTCGTCAAAGGCTGGGGCCAATGTTACACGAGACAGATTATCAGCAGTTGCCCCGGTTGGCTGGAGGTGATATCTAATAACCGGTGACTGGGACA
  5   1   2       bld Tbd7                                 XL068j16.5p                                                                                                                                                                  GGCTGCAGGNAATTCGGCACGAGGGCCCACTGGNACAACCCAGNACTCTAGGACGTTATTGGTCCATAAAGTATTCCCTGGATTTTCCATCAAAGCGTTTGACTATGAGAAGGCTTACAGTCTGCAGAGACCTAATGACCACGAGTTCATGCAACAACCATGGACCGGATTTACTGTACAGATAAGCTTCGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTTATCAGCAGTTGCCCGTGTTGGCTGGAGGTGATATTTAATAACCGGTGACTCGGACACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCCCGCGGACttgtttttacgttttttgttcgttttGAGAAATAGCTTATGTCAAGAATGACCTTTTTCTCATTCTGTTCTTGCCTGTGTGAATGACTTCAGGCCGAGCTTTGCCCCGGGTAGGGGACGGGTGCTTGGGCAACGCGTGGAGTGTGCTTGTAATGGGTTTTTTTGGGGGAGGGTATCGACCGCTTTCTTGTGCAATGAATAGA
  5   1   2       bld Tbd7                                 XL096n03.5p                                                                                                                                                                                         GGCCCACTGGNACAACCCAGNACTCTAGGACGTTATTGGTCCATAAAGTATTCCCTGGATTTTCCATCAAAGCGTTTGACTATGAGAAGGCTTACAGTCTGCAGAGACCTAATGACCACGAGTTCATGCAACAACCATGGACCGGATTTACTGTACAGATAAGCTTCGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTTATCAGCAGTTGCCCGTGTTGGCTGGAGGTGATATTTAATAACCGGTGACTCGGACACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCCCGCGGACttgtttttacgttttttgttcgttttGAGAAATAGCTTATGTCAAGAATGACCTTTTTCTCATTCTGTTCTTGCCTGTGTGAATGACTTCAGGCCGAGCTTTGCCCCGGGTAGGGGACGGGTGCTTGGGCAACGCGTGGAGTGTGCTTGTAATGGGTTTTTTTGGGGGAGGGTATCGACCGCTTTCTTGTGCAATGAATAGAAGATATTTTTGTCTAGGGTGGGGGGTTAGGACTGGGCTGAATTCAGTATTTTTCTTTTGCATATGGGTGACCACTACTACGCCTCCCAT
  5   1   2       bld Tbd7      in                         XL069i10.5p                                                                                                                                                                                                                                                                             AGAAGGCTTACAGTCTGCAGAGACCTAATGACCACGAGTTCATGCAACAACCATGGACCGGATTTACTGTNCAGATAAGCTTCGTCAAAGGCTGGGGCCAATGTTACACGAGAC
  3   1   2      seed Ov1  5g3  out                   IMAGE:5073018.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTCAGGCCGAGCTTTGCCCCGGGTAGGGGACGGGTGCTTGGGCAACGCGTGGAGTGTGCTTGTAATGGGTTTTTTTGGGGGAGGGTATCGACCGCTTTCTTGTGCAATGAATAGAAGATATTTTTGTCTAGGGTGGGGGGTTAGGACTGGGATGAATTCAGTATTTTTCTTTTGCATATGGGTGACCACTACTACGCCTCCCATCTCCTAAGTAAGGGCACGGCTGTATCAAGTATTCTAGTGGGCGACTTTAGAGCGACATCTAAGGTGTTTTTATTGGTTTATCCGTTGCAGGGATAACGGGAAAGGATGCTGATGCTGTTGCTAAGCAACGGCAAGGCCAATAATAATAATAAAGGCACCTTAGGTTGCTCTGCTACTATTTCTGCTGTCCTATAGCGAAACGAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACATGGATCACTCTCCAGGTCCGCTCCCGACCCAAGGTGTAAACATTATTGCGGAGTCTGATTTGCAGTGATCTGTTGTCCTATATCCCCGATAAAGACCAAACCCAAAAAAAAAAACTGCCATGCTGTTACCTGCCCCCCCCCAAAAAAAAAAAAAAAG
  5   1   2       bld Tad2      out                   IMAGE:6881358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAACGCGTGGAGTGTGCTTGTAATGGGTTTTTTTGGGGGAGGGTATCGACCGCTTTCTTGTGCAATGAATAGAAGATATTTTTGTCTAGGGTGGGGGGTTAGGACTGGGCTGAATTCAGTATTTTTCTTTTGCATATGGGTGACCACTACTACGCCTCCCATCTCCTAAGTAAGGGCACGGCTGTATCAAGTATTCTAGTGGGCGACTTTAGAGCGACATCTAAGGTGTTTTTATTGGTTTATCCGTTGCAGGGATAACGGGAAAGGATGCTGATGCTGTTGCTAAGCAACGGCAAGGCCAATAATAATAATAAAGGCACCTTAGGTTGCTCTGCTACTATTTCTGCTGTCCTATAGCGAAACGAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACATGGATCACTCTCCAGGTCCGCTCCCGACCCAAGGTGTAAACATTATTGCGGAGTCTGATTTGCAGTGATCTGTTGTCCTATATCCCCGATAAAGACCAAACCCaaaaaaaaaaaaactgccatgctgttacctgccccccccccaaaaaaaaaaaGAAAATCAAATAATCCAATTTTCTTGGACCTGCGGTTTTGTTGTTTTTAAACCGACCATTACAGGATAACTGCCCCACTTTGACCTTTTCTCCCTGTTATTTCAAGTCCCCCTTGGTGGAAAGGGGTTAACCCCCCAATTTATTCTTTTAATCGGTTTGCCCAAGGAAATATTCTGGGGAAAAATCACAAATTTTCAGGGCATGGCCCTTTAACCCC
  3   1   2       bld Tbd7      in                         XL069i10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATTTTTGTNTAGGGTGGGGGGTTAGGACTGGGCTGAATTCAGTATTTTTNTTTTGCANATGGGTGACCNCTACTACGCCTCCCATNTCCTAAGTAAGGGCCCGGCTGTATCAAGTATTNTAGTGGGCGACTTTANANCGACATNTAAGGTGTTTTTATTGGTTTATCCGTTGCAGGGATAACGGGAAAGGATGCTNATGCTGTTGCTAANCAACGGCAAGGCCAATAATAATAATAAAGGCCCCNTAGGNTGCTCTGCTACTATTTCTGCTGTCCTANANCGAAACGAGCNCTGCANACTNTTCAGACCAATGTCTTTTATTCNCGACTGGTAATTANACNTTTCNCATGGATCNCNCNCCAGGGCCGCNCCCGACCCAAGG
  5   1   2       bld Ga18      out                     xlk144m08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACTACGCCTCCCATCTCCTAAGTAAGGNCNCNNTGTATCAAGTATTCTAGTGGGCGACTTTAGAGCGACATCTAAGGTGTTTTTATTGGTTTATCCGTTGCAGGGATAACGGGAAAGGATGCTGATGCTGTTGCTAAGCAACGGCAAGNCNATAATAATAATAAAGGCACCTTAGGTTGCTCTGCTACTATTTCTGCTGTCCTATAGCGAAACGAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACATGGATCACTCTCCAGGTCCGCTCCCGACCCAAGGTGTAAACATTATTGCGGAGNCTGATTTGCAGTGATCTGTTGTCCTATATCCCCGATAAAGACCAAACCCAAAAAAAAACTGCCATTCTGTTACCTGccccccccccccnaaaaaaaaaaaG
  5   1   2       bld Ga12                                 XL201m02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGCGACATCTAAGGTGTTTTTATTGGTTTATCCGTTGCAGGGATAACGGGAAAGGATGCTGATGCTGTTGCTAAGCAACGGCAAGGCCAATAATAATAATAAAGGCACCTTAGGTTGCTCTGCTACTATTTCTGCTGTCCTATAGCGAAACGAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACATGGATCACTCTCCAGGTCCGCTCCCGACCCAAGGTGTAAACATTATTGCGGAGTCTGATTTGCAGTGATCTGTTGTCCTATATCCCCGATAAAGACCAAACCCaaaaaaaaactgccattctgttacctgccccccccccccccaaaaaaaaaa
  3   1   2       bld Sp1                             IMAGE:4173550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGTAATTATACATTTCACATGGATCACTCTCCAGGTCCGCTCCCGACCCAAGGTGTAAACATTATTGCGGAGTCTGATTTGCAGTGATCTGTTGTCCTATATCCCCGATAAAGACCAAACCCAAAAAAAAAAACTGCCATGCTGTTACCTGCCCCCCCCCCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)