Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 05 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012785519 Xl3.1-IMAGE:3579639.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:3579639.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACACAGTGCCGTGGATATAGAGAGTGCGCGTGCTCCCCGTGTATGTGTTTGCGTGTGCGCTGTGGGCCCCCGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACTTGGAGAGACTGGGCAGATTCCTATGGTCCTTGCCAGCCTGCGATCACCTCCACAAGAATGAGAGCGTCCTAAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTACAAGATCCTGGAGAGCCACCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCATTATGTGGAGGCAGAGAAACTGAGGGGGAGACCACTGGGGGCAGTGGGCAAGTACAGGGTCAGGAGGAAATTCCCGCTGCCCAGGACCATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCCTACCCGTCTCCCAGGGAGAAGCGGGAGTTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAG
                                                  Xl3.1-CHK-1012705069                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCCGTGGATATAGAGAGTGCGCGTGCTCCCCGTGTATGTGTTTGCGTGTGCGCTGTGGGCCCCCGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACTTGGAGAGACTGGGCAGATTCCTATGGTCCTTGCCAGCCTGCGATCACCTCCACAAGAATGAGAGCGTCCTAAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTACAAGATCCTGGAGAGCCACCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCATTATGTGGAGGCAGAGAAACTGAGGGGGAGACCACTGGGGGCAGTGGGCAAGTACAGGGTCAGGAGGAAATTCCCGCTGCCCAGGACCATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCCTACCCGTCTCCCAGGGAGAAGCGGGAGTTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     5     3     5     3     5     3     5     3     5     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     4     5     4     5     4     5     4     5     4     4     4     4
                                               BLH ATG      91     261                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      91     875                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      91      28                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 4e-063     NP_504420.1 C.Elegans Homeobox (ceh-33) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 2e-090     NP_476733.1 sine oculis CG11121-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 1e-093     NP_001071814.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ag ---- 2e-093     XP_320814.4 AGAP011695-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 7e-099     XP_001181583.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 7e-104     NP_033215.1 sine oculis homeobox homolog 1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 5e-104     NP_996978.1 sine oculis homeobox homolog 1 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 2e-104     NP_001082027.1 homeobox protein SIX1 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 2e-104     NP_001093693.1 SIX homeobox 1 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 1e-104     NP_005973.1 sine oculis homeobox homolog 1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 8e-105     NP_001038150.1 sine oculis homeobox homolog 1 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 5e-106     XP_547841.2 PREDICTED: similar to Homeobox protein SIX1 (Sine oculis homeobox homolog 1) [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Bt ---- 3e-107     XP_588692.2 PREDICTED: similar to LOC511371 protein [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:3579639.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------TGA---ATG---ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2       add Ga18 5g                            xlk71c10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGCTTTAAGGAGNNTGCTAACANNNGAGAAACAAAGTTGTTGGAGCTCNNNNAGCAGCATCCCCCAGACAAGCCAGCACTTTCCCTGCACACNGNNNNTGGATATAGAGAGTGCGCGTNCTCCCCGTGTATGTGTTTGCGTGTGCCTGTGGGCCCNNNNTNNNNNCACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGNAGGGAGGCAACTTGGAGAGACTGGGCAGATTCCTATGGTCCTTGCCAGCCTGCGATCACCTCCACAAGAATGAGAGCGTCCTAAAGGCAAAGGNCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTACAAGATCCTGGAGAGCCACCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCATTATGTGGAGGCAGAGAAACTGAGGGGGAGACCACTGGGGGCAGTNNNNNAGTACAGGGTCAGGAGGAAATTCCCGCTGCCCAGGACCATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGNCCCGAGGGGTGCTGAGAGAATGGNATGCCCATAACCCCTACCCGTCTCCCAGGGANAAGCGGGAGTTGNNTGAGGCACTGGNCTNANCACCACCCAGGTCAGCAATTGGTCAAGA
  5   1   2       bld Tbd5 5g                         IMAGE:3579639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGACAAGCCAGCACTTTCCCTGCACACAGTGCCGTGGATATAGAGAGTGCGCGTGCTCCCCGTGTATGTGTTTGCGTGTGCGCTGTGGGCCCCCGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACTTGGAGAGACTGGGCAGATTCCTATGGTCCTTGCCAGCCTGCGATCACCTCCACAAGAATGAGAGCGTCCTAAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTACAAGATCCTGGAGAGCCACCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCATTATGTGGAGGCAGAGAAACTGAGGGGGAGACCACTGGGGGCAGTGGGCAAGTACAGGGTCAGGAGGAAATTCCCGCTGCCCAGGACCATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCCTACCCGTCTCCCAGGGAGAAGCGGGAGTTGGCTGAGGCCACTGGACTAACCACCACCCANGTCAGCAATTGGTTCAAGAACAGGANGCAAAGGGACAGAGCCGCGGAGGCGAAAGAGAGGAAAATACTGAAAACATAACACATCCACCAACAACAGAATCAACTGTCACCCTAGACCGAATGAGTCGCTAATGTCAGTTCAGAAGAGGATTCTTGCCCCACAAAGCCTGATCAGAACTCG
  5   1   2       add Emb9 5g                         IMAGE:7974697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAGACAAGCCAACACTTTCCCTGCACACACTGCCGTGGATTTAGCAAGTTTGCTCCACTTATATGCGTTTGCGTGTGCGCGGTGGGCCCCCCGGCTATACTGAGCCATGTCTATGCTGCCTTCCTTCGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGTGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGCTTCTTATGGTCCTTACCGGCCTGTGATCACCTGCACAAGAACGAGAGCGTCCTGAAAGCGAAGGCGGTGGTGGCGTTTCATAGAGGCAACTTCAGAGAACTCTACAAGATCCTGGAGAGTCACCAGTTCTCCCCGCACAATCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAGGCCGAGAAACTGAGGGGGAGACCCCTGGGGGCGGTGGGCAAGTACAGGGTCAGGAGGAAATTCCCACTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATACCCATAACCCCTACCCGTCTCCCAGGGAGAAGCGCGAACTGGCCGAGGCCACTGGACTAACCACCACCCAGGTCAGCAACTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCTGCGGAGGCTAAAGAGAGGGAAAACACAGAAAACG
  5   1   2      seed DMZ  5g3  out                        xl304i09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATCGATTCGCCTGCACACAGTGCCGTGGATATAGAGAGTGCGCGTGCTCCCCGTGTATGTGTTTGCGTGTGCGCTGTGGGCCCCCGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACTTGGAGAGACTGGGCAGATTCCTATGGTCCTTGCCAGCCTGCGATCACCTCCACAAGAATGAGAGCGTCCTAAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTACAAGATCCTGGAGAGCCACCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCATTATGTGGAGGCAGAGAAACTGAGGGGGAGACCACTGGGGGCAGTGGGCAAGTACAGGGTCAGGAGGAAATTCCCGCTGCCCAGGACCATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCCTACCCGTCTCCCAGGGAGAAGCGGGAGTTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGA
  5   1   2       bld Emb4 5g                         IMAGE:5570268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTCCCTGCGCACAGTGCCGTGGATATAGAGAGTGCGCGTGCTCCCCGTGTATGTGTTTGCGTGTGCGCTGTGGGCCCCCGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACTTGGAGAGACTGGGCAGATTCCTATGGTCCTTGCCAGCCTGCGATCACCTCCACAAGAATGAGAGCGTCCTAAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTACAAGATCCTGGAGAGCCACCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCATTATGTGGAGGCAGAGAAACTGAGGGGGAGACCACTGGGGGCAGTGGGCAAGTACAGGGTCAGGAGGAAATTCCCGCTGCCCAGGACCATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCCTACCCGTCTCCCAGGGAGAAGCGGGAGTTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAGGCGAAAAGAGAGGGAAAATACCGAAAACAATAACACATCTACCACCAAACAGAATCAACTGTCACCCCCTAAACCGGAGGGAAATCGCTAATGTCCCAGTTCAAAAGAGGGATTTCTCGccccccccaaagcccccGGATCCAAAACTCGGGGGCTTCCTGGTTGCAGGGGAAACCTTAACCCAACCCGGGGGCCAACCTCCCTTACCCCCCGGAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)