Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012785543 Xl3.1-IMAGE:5079915.5 - 4 ESTs
                                                                       .-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5079915.5                                                                                                                                                                  GGACCGGTCCGGAATTCCNCGGGATGATAAAAGGAAGCACTGCTTTGCAACTTGGAAGAACATTTCGGGCTCCATAGAAATTGTTAAGCAAGGCTGCTGGTTGGACGATATCAACTGCTATAACAAGAGCAAATGCACAGAGAAAAAGGATAGTCCAGATGTGTTTTTCTGTTGCTGCGAAGGAAACTATTGCAATGAAAAGTTCTACCATTCACCAGAGATGGAGGTCACACAGCCCACCTCAAATCCTGTCACAACTAAGCCTCCTTTATTCAACACTCTGCTCTACTCACTGGTGCCTATCATGGTGGTTGCAGTGATTGTTCTCTTCTCGTTTTGGATGTACCGACATCACAAGCTCGCCTACCCCCCAGTGCTGGTTCCAACACAGGACCCAGGCCCCCCTCCTCCGTCTCCTCTGCTGGGATTAAAGCCGTTGCAGCTATTGGAGGTGAAAGCCAGAGGGAGGTTTGGCTGCGTGTGGAAAGCCCAGTTATTAAATGAAACCGTAGCTGTCAAGATATTCCCTGTACAGGATAAACTGTCTTGGCAAAACGAGTATGAAATCTACAGCCTCCCTGGGATGAAGCATGAGAATATCCTGTACTTCATTGGCGCCGAAAAACGTGGCACAAACCTTGACACAGATCTGTGGTTAATTACTGCTTTCCACGAAAAGGGCTCCCTGACAGACTATCTCAAAGCCAACGTGGTGTCTTGGAATGAGCTTTGCCTCATCGCTGAGACAATGGCCAGAGGTTTATCTCACCTCCATGAAGATATCCCAGGACTCAAAGATGGACACAAGCCTGCGGTAGCACATAGGGATATTAAAAGCAAAAATGTGCTACTTAAAAACAATCTGACAGCCTGTATAGCAGACTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGGCAGGTTGGGACCCGCAGGTACATGGCTCCAGAAGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCGTTTGGTTTAGTACTTTGGGAGCTGGCATCAAGGTGCACTGCCTCAGATGGTCCTGTCGATGAGTATATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTTGAGGACATGCAAGAAGTGGTAGTGCACAAAAAGAAAAGACCCATTTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGGATCACGAAGCAGAGGCCAGGTTATCAGCCGGGCTGCGTAGAAGAGCGAATCAATCAAATGCAAAAACTCACAAACATTATCACCCCCGAAGGACATTGTAACAGTCGTAACGATGGTGACCAACGTGGACTTTCCGCCCAAGAATCAAGCCTATGAAACCCTCAGTCATAAACGGGACTCTGGTGGCAAAGCTGCTAAACCTAAGGGGAAACTTCTGCCTTAAAAGCCAAATAACGGCAAAGTCCCCGTGAAATCGCAGTG
                                                  Xl3.1-CHK-1012707702                                                                                                                                                                        GTCCGGAATTCCNCGGGATGATAAAAGGAAGCACTGCTTTGCAACTTGGAAGAACATTTCGGGCTCCATAGAAATTGTTAAGCAAGGCTGCTGGTTGGACGATATCAACTGCTATAACAAGAGCAAATGCACAGAGAAAAAGGATAGTCCAGATGTGTTTTTCTGTTGCTGCGAAGGAAACTATTGCAATGAAAAGTTCTACCATTCACCAGAGATGGAGGTCACACAGCCCACCTCAAATCCTGTCACAACTAAGCCTCCTTTATTCAACACTCTGCTCTACTCACTGGTGCCTATCATGGTGGTTGCAGTGATTGTTCTCTTCTCGTTTTGGATGTACCGACATCACAAGCTCGCCTACCCCCCAGTGCTGGTTCCAACACAGGACCCAGGCCCCCCTCCTCCGTCTCCTCTGCTGGGATTAAAGCCGTTGCAGCTATTGGAGGTGAAAGCCAGAGGGAGGTTTGGCTGCGTGTGGAAAGCCCAGTTATTAAATGAAACCGTAGCTGTCAAGATATTCCCTGTACAGGATAAACTGTCTTGGCAAAACGAGTATGAAATCTACAGCCTCCCTGGGATGAAGCATGAGAATATCCTGTACTTCATTGGCGCCGAAAAACGTGGCACAAACCTTGACACAGATCTGTGGTTAATTACTGCTTTCCACGAAAAGGGCTCCCTGACAGACTATCTCAAAGCCAACGTGGTGTCTTGGAATGAGCTTTGCCTCATCGCTGAGACAATGGCCAGAGGTTTATCTCACCTCCATGAAGATATCCCAGGACTCAAAGATGGACACAAGCCTGCGGTAGCACATAGGGATATTAAAAGCAAAAATGTGCTACTTAAAAACAATCTGACAGCCTGTATAGCAGACTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGGCAGGTTGGGACCCGCAGGTACATGGCTCCAGAAGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCGTTTGGTTTAGTACTTTGGGAGCTGGCATCAAGGTGCACTGCCTCAGATGGTCCTGTCGATGAGTATATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTTGAGGACATGCAAGAAGTGGTAGTGCACAAAAAGAAAAGACCCATTTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGGATCACGAAGCAGAGGCCAGGTTATCAGCCGGGCTGCGTAGAAGAGCGAATCAATCAAATGCAAAAACTCACAAACATTATCACCCCCGAAGGACATTGTAACAGTCGTAACGATGGTGACCAACGTGGACTTTCCGCCCAAGAATCAAGCCTATGAAACCCTCAGTCATAAACGGGACTCTGGTGGCAAAGCTGCTAAACCTAAGGGGAAACTTCTGCCTTAAAAGCCAAATAACGGCAAAGTCCCCGTGAAATCGCAGTGGGGGTT
                                                      consensus depths                                                                                                                                                                       1     1     1     1     1     1     1     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---= 9e-048     NP_001021148.1 abnormal DAuer Formation family member (daf-4) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 2e-059     XP_616508.4 PREDICTED: similar to activin receptor-like kinase 7 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PROTEIN --- Dm ---- 7e-111     NP_731926.1 punt CG7904-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 5e-113     NP_001071835.1 transforming growth factor beta receptor [Ciona intestinalis] ---------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                        PROTEIN --- Ag ---- 8e-117     XP_311300.3 AGAP000763-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PREDICTED - Sp ---- 6e-137     XP_001194466.1 PREDICTED: similar to activin receptor:ISOTYPE=IIA [Strongylocentrotus purpuratus] ---------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PROTEIN --- Dr ---- 0          NP_001103748.1 activin receptor IIa [Danio rerio] ------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PREDICTED - Cf ---- 0          XP_857463.1 PREDICTED: similar to Activin receptor type II precursor (ACTR-II) isoform 6 [Canis familiaris] -----------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Bt ---- 0          NP_776652.1 activin A receptor, type II [Bos taurus] ------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Mm ---- 0          NP_031422.3 activin receptor IIA precursor [Mus musculus] -------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Hs ---- 0          NP_001607.1 activin A type II receptor precursor [Homo sapiens] -------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN --- Gg ---- 0          NP_990698.1 activin receptor IIA [Gallus gallus] ----------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PROTEIN --- Xl ---- 0          NP_001084061.1 activin receptor [Xenopus laevis] ----------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5079915.5                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------ATG---ATG------------------------------------------------------------------TAG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2      seed Oo1                             IMAGE:5079915.5p                                                                                                                                                                  GGACCGGTCCGGAATTCCNCGGGATGATAAAAGGAAGCACTGCTTTGCAACTTGGAAGAACATTTCGGGCTCCATAGAAATTGTTAAGCAAGGCTGCTGGTTGGACGATATCAACTGCTATAACAAGAGCAAATGCACAGAGAAAAAGGATAGTCCAGATGTGTTTTTCTGTTGCTGCGAAGGAAACTATTGCAATGAAAAGTTCTACCATTCACCAGAGATGGAGGTCACACAGCCCACCTCAAATCCTGTCACAACTAAGCCTCCTTTATTCAACACTCTGCTCTACTCACTGGTGCCTATCATGGTGGTTGCAGTGATTGTTCTCTTCTCGTTTTGGATGTACCGACATCACAAGCTCGCCTACCCCCCAGTGCTGGTTCCAACACAGGACCCAGGCCCCCCTCCTCCGTCTCCTCTGCTGGGATTAAAGCCGTTGCAGCTATTGGAGGTGAAAGCCAGAGGGAGGTTTGGCTGCGTGTGGAAAGCCCAGTTATTAAATGAAACCGTAGCTGTCAAGATATTCCCTGTACAGGATAAACTGTCTTGGCAAAACGAGTATGAAATCTACAGCCTCCCTGGGATGAAGCATGAGAATATCCTGTACTTCATTGGCGCCGAAAAACGTGGCACAAACCTTGACACAGATCTGTGGTTAATTACTGCTTTCCACGAAAAGGGCTCCCTGACAGACTATCTCAAAGCCAACGTGGTGTCTTGGAATGAGCTTTGCCTCATCGCTGAGACAATGGCCAGAGGTTTATCTCACCTCCATGAAGATATCCCAGGACTCCAAGATGGACACAAGCCTGCGGTAGCACCATAAGGATATTAAAAGCAAAAATGTGCTACTTAAAAACAATCTGACAGCCTGTATAGCAGACTCCGCCCTCGCCTTAAAAGTTCAAGGCTGGGAAATCTGCAGGGGACACTCACGGGGCAGGA
  5   1   2       bld Em10                            IMAGE:8319692.5p                                                                                                                                                                                                         CTGCTTTGCAACTTGGAAGAACATTTCGGGCTCCATAGAAATTGTTAAGCAAGGCTGCTGGTTGGACGATATCAACTGCTATAACAAGAGCAAATGCACAGAGAAAAAGGATAGTCCAGATGTGTTTTTCTGTTGCTGCGAAGGAAACTATTGCAATGAAAAGTTCTACCATTCACCAGAGATGGAGGTCACACAGCCCACCTCAAATCCTGTCACAACTAAGCCTCCTTTATTCAACACTCTGCTCTACTCACTGGTGCCTATCATGGTGGTTGCAGTGATTGTTCTCTTCTCGTTTTGGATGTACCGACATCACAAGCTCGCCTACCCCCCAGTGCTGGTTCCAACACAGGACCCAGGCCCCCCTCCTCCGTCTCCTCTGCTGGGATTAAAGCCGTTGCAGCTATTGGAGGTGAAAGCCAGAGGGAGGTTTGGCTGCGTGTGGAAAGCCCAGTTATTAAATGAAACCGTAGCTGTCAAGATATTCCCTGTACAGGATAAACTGTCTTGGCAAAACGAGTATGAAATCTACAGCCTCCCTGGGATGAAGCATGAGAATATCCTGTACTTCATTGGCGCCGAAAAACGTGGCACAAACCTTGACACAGATCTGTGGTTAATTACTGCTTTCCACGAAAAGGGCTCCCTGACAGACTATCTCAAAGCAAACGTGGTGTCTTGGAATGAGCTTTGCCTCATCGCTGAGACAATGGCCAGAGGTTTATCTCACCTCCATGAAGATA
  5   1   2       bld Em10                            IMAGE:8319875.5p                                                                                                                                                                                                          CTGCTTTGCACTTGGAAGAACATTTCGGGCTCCATAGAAATTGTTAAGCAAGGCTGCTGGTTGGACGATATCAACTGCTATAACAAGAGCAAATGCACAGAGAAAAAGGATAGTCCAGATGTGTTTTTCTGTTGCTGCGAAGGAAACTATTGCAATGAAAAGTTCTACCATTCACCAGAGATGGAGGTCACACAGCCCACCTCAAATCCTGTCACAACTAAGCCTCCTTTATTCAACACTCTGCTCTACTCACTGGTGCCTATCATGGTGGTTGCAGTGATTGTTCTCTTCTCGTTTTGGATGTACCGACATCACAAGCTCGCCTACCCCCCAGTGCTGGTTCCAACACAGGACCCAGGCCCCCCTCCTCCGTCTCCTCTGCTGGGATTAAAGCCGTTGCAGCTATTGGAGGTGAAAGCCAGAGGGAGGTTTGGCTGCGTGTGGAAAGCCCAGTTATTAAATGAAACCGTAGCTGTCAAGATATTCCCTGTACAGGATAAACTGTCTTGGCAAAACGAGTATGAAATCTACAGCCTCCCTGGGATGAAGCATGAGAATATCCTGTACTTCATTGGCGCCGAAAAACGTGGCACAAACCTTGACACAGATCTGTGGTTATTACTGCTTTCCACGAAAGGGCTCCCTGACAACTATCTCAAAGCAACGTGGTGTCTGGAATGAGCNTTGCTCACGCTGAGACATGGCAGAGGTTATCTCACTCATGAGATATCCAGATCAAGATGACACAGCTGCGTAGCCTAGGATATAAACAAATGGCTATAAACATCGACGC
  5   1   2       bld Egg3                            IMAGE:6868676.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGAATCTCGCCTCCCTGGGATGAACATGAGAATATCCTGTACTTCATTGGCGCCGAAAACGTGGCACAAACCTTGACACGATCTGTGGTTAATTACTGCTTTCCACGAAAAGGGCTCCCTGACAGACTATCTCAAAGCCAACGTGGTGTCTTGGAATGAGCTTTGCCTCATCGCTGAGACAATGGCCAGAGGTTTATCTCACCTCCATGAAGATATCCCAGGACTCAAAGATGGACACAAGCCTGCGGTAGCACATAGGGATATTAAAAGCAAAAATGTGCTACTTAAAAACAATCTGACAGCCTGTATAGCAGACTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGGCAGGTTGGGACCCGCAGGTACATGGCTCCAGAAGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCGTTTGGTTTAGTACTTTGGGAGCTGGCATCAAGGTGCACTGCCTCAGATGGTCCTGTCGATGAGTATATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTTGAGGACATGCAAGAAGTGGTAGTGCACAAAAAGAAAAGACCCATTTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGGATCACGAAGCAGAGGCCAGGTTATCAGCCGGGCTGCGTAGAAGAGCGAATCAATCAAATGCAAAAACTCACAAACATTATCACCCCCGAAGGACATTGTAACAGTCGTAACGATGGTGACCAACGTGGACTTTCCGCCCAAGAATCAAGCCTATGAAACCCTCAGTCATAAACGGGACTCTGGTGGCAAAGCTGCTAAACCTAAGGGGAAACTTCTGCCTTAAAAGCCAAATAACGGCAAAGTCCCCGTGAAATCGCAGTGGGGGTTGCTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)