Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL070d24.3                           12 PI      74        278      882                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8532738.5                       6 PI      93        649     1116                Pituitary homeobox 2 (xPtx2)
     3   0.0    0Xl3.1-IMAGE:5542798.5                       3 PI      91        191      482                Pitx2-A protein [Xenopus laevis]
     4   0.0    0Xl3.1-XL100o10.5                            3 PI      82        251      519                paired-like homeodomain transcription factor 3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 68%

 1012785599 Xl3.1-IMAGE:8535754.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8535754.5 CAGAATGGACAGCAACTGCCGCAAACTGGTGACAACCTGTGTCCAACTAGGAGTGCAGCCCTCGGCAGTGGAGTGTCTCTTTTCTAAGGAGTCTGATATGAAGAAGGGGGGTTTTCCTGCTGCAGATGGAACCGAAGGAAACCGCAAGGAAACTGGAAAACGGTTTAGCCGGATTCACCAAAGTGGCAGTGATAAAGACAAAAGCCACCAGAGCAAGAACGAGGACAACAGTACAGATGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAGAGGACTCACTTCACCAGTCAGCAGCTGCAGGAGCTGGAAGCGACTTTCCAGAGAAATCGTTACCCCGACATGTCCACCAGGGAGGAAATCGCAGTGTGGACCAATCTGACAGAGGCCAGAGTCAGGGTTTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAAACTGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTCAATGGACTGATGCAGCCATATGATGATATGTACCCCAGTTACTCGTACAACAACTGGGCAACCAAGGGCCTGACTTCAGCCTCTCTGTCCACTAAGAGCTTTCCTTTCTTCAATTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCCATGAGCATGTCCTCTGGCATGGTCCCCTCTGCTGTTACTGGAGTGCCAGGCTCTGGTCTAAATAGCTTGAATAACCTGAACAATTTGAGCAACCCTTCCCTCAATACTGCAGTGCCAACGTCGGCCTGCCCTTATGCTCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAGCAACACTCTAGTTTTGGCTATGTTCAAAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACCTGTGTATATGTGTGAGCCTGTATATATACTGTCCTGTATGGGAAGTACTCTGAAACCTCTAAATCACATACCTGGGTCACTACCAAAAGAGATCAGACATGGAGGAACATGCAGAAACGCCAATTTTAATTTGTTATTCCAGCGATGTCCTGCAGTG
                                                  Xl3.1-CHK-1012708432       GGACAGCAACTGCCGCAAACTGGTGACAACCTGTGTCCAACTAGGAGTGCAGCCCTCGGCAGTGGAGTGTCTCTTTTCTAAGGAGTCTGATATGAAGAAGGGGGGTTTTCCTGCTGCAGATGGAACCGAAGGAAACCGCAAGGAAACTGGAAAACGGTTTAGCCGGATTCACCAAAGTGGCAGTGATAAAGACAAAAGCCACCAGAGCAAGAACGAGGACAACAGTACAGATGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAGAGGACTCACTTCACCAGTCAGCAGCTGCAGGAGCTGGAAGCGACTTTCCAGAGAAATCGTTACCCCGACATGTCCACCAGGGAGGAAATCGCAGTGTGGACCAATCTGACAGAGGCCAGAGTCAGGGTTTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAAACTGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTCAATGGACTGATGCAGCCATATGATGATATGTACCCCAGTTACTCGTACAACAACTGGGCAACCAAGGGCCTGACTTCAGCCTCTCTGTCCACTAAGAGCTTTCCTTTCTTCAATTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCCATGAGCATGTCCTCTGGCATGGTCCCCTCTGCTGTTACTGGAGTGCCAGGCTCTGGTCTAAATAGCTTGAATAACCTGAACAATTTGAGCAACCCTTCCCTCAATACTGCAGTGCCAACGTCGGCCTGCCCTTATGCTCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAGCAACACTCTAGTTTTGGCTATGTTCAAAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACCTGTGTATATGTGTGAGCCTGTATATATACTGTCCTGTATGGGAAGTACTCTGAAACCTCTAAATCACATACCTGGGTCACTACCAAAAGAGATCAGACATGGAGGAACATGCAGAAACGCCAATTTTAATTTGTTATTCCAGCGATGTCCT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1
                                               BLH ATG       4     136 
  5   1   2       add Em10 5g                         IMAGE:7980120.5p CAGAATGGACAGCAACTGCCGCAAACTGGTGACAACCTGTGTCCAACTAGGAGTGCAGCCCTCGGCAGTGGAGTGTCTCTTTTCTAAGGAGTCTGATATGAAGAAGGGGGGTTTTCCTGCTGCAGATGGAACCGAAGGAAACCGCAAGGAAACTGGAAAACGGTTTAGCCGGATTCACCAAAGTGGCAGTGATAAAGACAAAAGCCACCAGAGCAAGAACGAGGACAACAGTACAGATGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAGAGGACTCACTTCACCAGTCAGCAGCTGCAGGAGCTGGAAGCGACTTTCCAGAGAAATCGTTACCCCGACATGTCCACCAGGGAGGAAATCGCAGTGTGGACCAATCTGACAGAGGCCAGAGTCAGGGTTTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAAACTGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTCAATGGACTGATGCAGCCATATGATGATATGTACCCCAGTTACTCGTACAACAACTGGGCAACCAAGGGCCTGACTTCAGCCTCTCTGTCCACTAAGAGCTTTCCTTTCTTCAATTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCATGAGCATGTCTCTGGCATGGTCCCTCTGCTGTACTGGAGTGCAGGCTCTGGTCTATAGCTTGATACCCTGACATTTAGCACCCTTCTCATATGCATGCACGTCGCTGCCTAGCTCCCACACTCCTTGTTCGAGACCTTACTCGCTGCACCTAATCAGCACA
  5   1   2      seed Em10                            IMAGE:8322272.5p                                                                                                                                                                    GGGAAGTGTGTGAAATCGATTTGCCGCTATAAAGACAAAAGCCACCAGAGCAAGAACGAGGACAACAGTACAGATGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAGAGGACTCACTTCACCAGTCAGCAGCTGCAGGAGCTGGAAGCGACTTTCCAGAGAAATCGTTACCCCGACATGTCCACCAGGGAGGAAATCGCAGTGTGGACCAATCTGACAGAGGCCAGAGTCAGGGTTTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAAACTGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTCAATGGACTGATGCAGCCATATGATGATATGTACCCCAGTTACTCGTACAACAACTGGGCAACCAAGGGCCTGACTTCAGCCTCTCTGTCCACTAAGAGCTTTCCTTTCTTCAATTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCCATGAGCATGTCCTCTGGCATGGTCCCCTCTGCTGTTACTGGAGTGCCAGGCTCTGGTCTAAATAGCTTGAATAACCTGAACAATTTGAGCAACCCTTCCCTCAATACTGCAGTGCCAACGTCGGCCTGCCCTTATGCTCCCCCAACACCTCCCTATGTCTACAGAGACACATGGTACTCCAGCCTGGCAAGCCTGAGACTTCAAG
  5   1   2       bld Lmb1                            IMAGE:8535754.5p                                                                                                                                                                                                                                                                          CGACAGAGGACTCACTTCACCAGTCAGCAGCTGCAGGAGCTGGAAGCGACTTTCCAGAGAAATCGTTACCCCGACATGTCCACCAGGGAGGAAATCGCAGTGTGGACCAATCTGACAGAGGCCAGAGTCAGGGTTTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAAACTGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTCAATGGACTGATGCAGCCATATGATGATATGTACCCCAGTTACTCGTACAACAACTGGGCAACCAAGGGCCTGACTTCAGCCTCTCTGTCCACTAAGAGCTTTCCTTTCTTCAATTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCCATGAGCATGTCCTCTGGCATGGTCCCCTCTGCTGTTACTGGAGTGCCAGGCTCTGGTCTAAATAGCTTGAATAACCTGAACAATTTGAGCAACCCTTCCCTCAATACTGCAGTGCCAACGTCGGCCTGCCCTTATGCTCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAGCAACACTCTAGTTTTGGCTATGTTCAAAACCCAGGATCCNACCTCAGCGCCCTGCCATATGCAGTGGACAGACCCGTGTGATACCTGTGTATATGTGTGAGCCTGTAATATACTGTCCTGTATGGAAGTACTCTGAACCTCTAAATCACTACTGGGTCCTACNAAAGAGATCGACTGGAGAACTGCAGACGCCATTTTATGTTATCACG
  5   1   2       bld Em10                            IMAGE:8319378.5p                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGTCAGGGTTTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAAACTGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTCAATGGACTGATGCAGCCATATGATGATATGTACCCCAGTTACTCGTACAACAACTGGGCAACCAAGGGCCTGACTTCAGCCTCTCTGTCCACTAAGAGCTTTCCTTTCTTCAATTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCCATGAGCATGTCCTCTGGCATGGTCCCCTCTGCTGTTACTGGAGTGCCAGGCTCTGGTCTAAATAGCTTGAATAACCTGAACAATTTGAGCAACCCTTCCCTCAATACTGCAGTGCCAACGTCGGCCTGCCCTTATGCTCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAGCAACACTCTAGTTTTGGCTATGTTCAAAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACCTGTGTATATGTGTGAGCCTGTATATATACTGTCCTGTATGGGAAGTACTCTGAAACCTCTAAATCACATACCTGGGTCACTACCAAAAGAGATCAGACATGGAGGAACATGCAGAAACGCCAATTTTAATTTGTTATTCCAGCGATGTCCTGCAGTGAAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)