Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-rxlk161p20ex.3                        6 END     2          50       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8319185.5                       2 PI      96         24      236                beta-1,4-galactosyltransferase [Gallus gallus]
     3   0.0    0Xl3.1-XL452k11ex.5                          2 PI      92         23      315                beta-1,4-galactosyltransferase [Gallus gallus]
     4   0.0    0Xl3.1-XL054m18.5                            2 PI      83       1154     1519                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012785697 Xl3.1-IMAGE:4057049-IMAGp.5 - 4 ESTs
                                                                       -320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4057049-IMAGp.5                                                                                                                                                                                                                                                                                                                                 CACGCGTCCGCCCACGCGTCCGGGGGATTCATTTACACCCAGTGCCAAGTTGGAACTCAATTTAACCGTCACAGAGAAACCCTTGCTTCCATGTCCTGATGCACCTCCGGGTCTAGTTGGCCGATTACTGATTGAATTCAGCTCTCTTATGAGCATGGAAAGAGTTCAGAGGGAAAATCCTGATGTGACTGAAGGTGGGAGGTACGTGCCTCCTGACTGCCAGCCAAAGGAAAAGGTGGCAATAATCATTCCTTTTAGACACAGAGAACATCACCTTAAATACTGGCTTCATTACCTTCACCCTATACTGAGACGCCAGAAAGTTGCATACGGAATTTACATTATCAATCAGTTTGGCGAGGACACTTTCAATCGGGCCAAGCTATTGAATATTGGTTTTCTGGAAGCAATGAAAGAGGCAGACTATGACTGTTTCATTTTCAGTGATGTGGATCTTATTCCTATGGATGACAGAAATTTATATCATTGCTATGAGCAGCCACGGCATTTTGCCATTGCCATGGACAAGTTTGCATTCCGGTTGCCATATGCAGGCTATTTTGGAGGGGTCTCTGGACTAAGCAAAGCCCAGTTTTTGAAGATAAATGGTTTTCCCAACGAATACTGGGGATGGGGAGGAGAAGACGATGATATTTATAACAGAATAACCCACAATGGCATGAAAATTTCCCGGCCTGATATCCACGTTGGACGTTATCGAATGATCAAACATGAACGAGACAAGCACAATGAGCCCAATCCTCAAAGATTTACAAAGATTCAGAATACGAAGATGACTATGAAGAAAGATGGCATCAATTCATTGCACTACCGTGTGATCCACTCTGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCACCCAGACCTGCCCGGGGATAAAGCAATGCACTCAGCACTTCTCCCGACAGCCTAATTCTTTCTCCTTTCATTTTGGAAGAAGGAGAGGAAATGCAGTTAAAACTATACTTCTGCCTCCTCCAGGGGTTTTTCCATTACCGTTATGTGGCAGTTTGCCTGGTTCATCTGTACACCACGGAAGGACTGACCTATTCTAGTAAAGAATAAACAAACTCGGTGCTCATGAGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGACTTAATCCATCTGCTACATTTTAGTACTTCCTTGTTCTTCTTTTTTTTATTTTTTAAATCTTTTATAAAACAACAGATTTTCTTCTCCATTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGTACTATAACCGCTCACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAACATGAATATACTAATAGCCTATAAACTCAAGGTCACTTTGGATGCTAAAATATACACTTTTAATCTTGCCCTGAACACTTGCACTACAGGGCAACAATGAGAGCTAAAACTAATGTAACCGTGCATATCTACTTTAATANGATGCTGCTAAATCATCTAGCCTAGGTACCACTATAACAGTTACAGAGTA
                                                  Xl3.1-CHK-1012709330                                                                                                                                                                                                                                                                                                                                       TCCGCCCACGCGTCCGGGGGATTCATTTACACCCAGTGCCAAGTTGGAACTCAATTTAACCGTCACAGAGAAACCCTTGCTTCCATGTCCTGATGCACCTCCGGGTCTAGTTGGCCGATTACTGATTGAATTCAGCTCTCTTATGAGCATGGAAAGAGTTCAGAGGGAAAATCCTGATGTGACTGAAGGTGGGAGGTACGTGCCTCCTGACTGCCAGCCAAAGGAAAAGGTGGCAATAATCATTCCTTTTAGACACAGAGAACATCACCTTAAATACTGGCTTCATTACCTTCACCCTATACTGAGACGCCAGAAAGTTGCATACGGAATTTACATTATCAATCAGTTTGGCGAGGACACTTTCAATCGGGCCAAGCTATTGAATATTGGTTTTCTGGAAGCAATGAAAGAGGCAGACTATGACTGTTTCATTTTCAGTGATGTGGATCTTATTCCTATGGATGACAGAAATTTATATCATTGCTATGAGCAGCCACGGCATTTTGCCATTGCCATGGACAAGTTTGCATTCCGGTTGCCATATGCAGGCTATTTTGGAGGGGTCTCTGGACTAAGCAAAGCCCAGTTTTTGAAGATAAATGGTTTTCCCAACGAATACTGGGGATGGGGAGGAGAAGACGATGATATTTATAACAGAATAACCCACAATGGCATGAAAATTTCCCGGCCTGATATCCACGTTGGACGTTATCGAATGATCAAACATGAACGAGACAAGCACAATGAGCCCAATCCTCAAAGATTTACAAAGATTCAGAATACGAAGATGACTATGAAGAAAGATGGCATCAATTCATTGCACTACCGTGTGATCCACTCTGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCACCCAGACCTGCCCGGGGATAAAGCAATGCACTCAGCACTTCTCCCGACAGCCTAATTCTTCCTCCTTTCATTTTGGAAGAAGGAGAGGAAATGCAGTTAAAACTATACTTCTGCCTCCTCCAGGGGTTTTTCCATTACCGTTATGTGGCAGTTTGCCTGGTTCATCTGTACACCACGGAAGGACTGACCTATTCTAGTAAAGAATAAACAAACTCGGTGCTCATGAGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGACTTAATCCATCTGCTACATTTTAGTACTTCCTTGTTCTTCTTTTTTTTATTTTTTAAATCTTTTATAAAACAACAGATTTTCTTCTCCATTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGTACTATAACCGCTCACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAACATGAATATACTAATAGCCTATAAACTCAAGGTCACTTTGGATGCTAAAATATACACTTTTAATCTTGCCCTGAACACTTGCACTACAGGGCAACAATGAGAGCTAAAACTAATGTAACCGTGCATATCTACTTTAATANGATGCTGCTAAATCATCTAGCCTAGGTACCACTATAACAGTTACAGAGTACTGTGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                      1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       PREDICTED - Sp ---- 3e-056     XP_001185751.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PROTEIN --- Dm ---- 1e-064     NP_610946.1 CG8536-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Ce ---- 4e-067     NP_490872.1 {beta}4GalNAcT: UDPGalNAc:GlcNAc{beta}-R{beta}1,4-N-acetylgalactosaminyltransferase (43.9 kD) (1C94) [Caenorhabditiselegans] ------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 4e-075     XP_318033.4 AGAP004781-PA [Anopheles gambiae str. PEST] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN --- Ci ---- 1e-081     NP_001027773.1 beta 4 galactosyltransferase [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 2e-094     NP_001086883.1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 [Xenopus laevis] ---===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Xt ---- 1e-104     CAJ83025.1 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Mm ---- 1e-131     NP_059073.1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Bt ---- 2e-136     NP_001098500.1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PREDICTED - Cf ---- 1e-137     XP_539644.1 PREDICTED: similar to Beta-1,4-galactosyltransferase 2 (Beta-1,4-GalTase 2) (Beta4Gal-T2) (b4Gal-T2) (UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 2) (UDP-Gal:beta-GlcNAc beta-1,4-galactosyltransferase 2) [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN --- Hs ---- 4e-138     NP_001005417.1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase 2 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PREDICTED - Dr ---- 8e-149     NP_001121857.1 hypothetical protein LOC100148828 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Gg ---- 3e-150     NP_990534.1 beta-1,4-galactosyltransferase [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4057049-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------ATG---ATG---------------------------------------------------------ATG------------------------------------------------------TAA---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------------ATG------------------------ATG------ATG------------TAA------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TGA------TAATAG------------------------ATG---------------------------TGA------------------------------TAA---TAA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       bld Lu1       out                   IMAGE:4057049.5p                                                                                                                                                                                                                                                                                                                                 CACGCGTCCGCCCACGCGTCCGGGGGATTCATTTACACCCAGTGCCAAGTTGGAACTCAATTTAACCGTCACAGAGAAACCCTTGCTTCCATGTCCTGATGCACCTCCGGGTCTAGTTGGCCGATTACTGATTGAATTCAGCTCTCTTATGAGCATGGAAAGAGTTCAGAGGGAAAATCCTGATGTGACTGAAGGTGGGAGGTACGTGCCTCCTGACTGCCAGCCAAAGGAAAAGGTGGCAATAATCATTCCTTTTAGACACAGAGAACATCACCTTAAATACTGGCTTCATTACCTTCACCCTATACTGAGACGCCAGAAAGTTGCATACGGAATTTACATTATCAATCAGTTTGGCGAGGACACTTTCAATCGGGCCAAGCTATTGAATATTGGTTTTCTGGAAGCAATGAAAGAGGCAGACTATGACTGTTTCATTTTCAGTGATGTGGATCTTATTCCTATGGATGACAGAAATNTATATCATTGCTATGAGCAGCCA
  5   1   2      seed Lu1                    IMAGE:4057049-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                       GGGGATTCATTTACACCCAGTGCCAAGTTGGAACTCAATTTAACCGTCACAGAGAAACCCTTGCTTCCATGTCCTGATGCACCTCCGGGTCTAGTTGGCCGATTACTGATTGAATTCAGCTCTCTTATGAGCATGGAAAGAGTTCAGAGGGAAAATCCTGATGTGACTGAAGGTGGGAGGTACGTGCCTCCTGACTGCCAGCCAAAGGAAAAGGTGGCAATAATCATTCCTTTTAGACACAGAGAACATCACCTTAAATACTGGCTTCATTACCTTCACCCTATACTGAGACGCCAGAAAGTTGCATACGGAATTTACATTATCAATCAGTTTGGCGAGGACACTTTCAATCGGGCCAAGCTATTGAATATTGGTTTTCTGGAAGCAATGAAAGAGGCAGACTATGACTGTTTCATTTTCAGTGATGTGGATCTTATTCCTATGGATGACAGAAATTTATATCATTGCTATGAGCAGCCACGGCATTTTGCCATTGCCATGGACAAGTTTGCATTCCGGTTGCCATATGCAGGCTATTTTGGAGGGGTCTCTGGACTAAGCAAAGCCCAGTTTTTGAAGATAAATGGTTTTCCCAACGAATACTGGGGATGGGGAGGAGAAGACGATGATATTTATAACAGAATAACCCACAATGGCATGAAAATTTCCCGGCCTGATATCCACGTTGGACGTTATCGAATGATCAAACATGAACGAGACAAGCACAATGAGCCCAATCCTCAAAGATTTACAAAGATTCAGAATACGAAGATGACTATGAAGAAAGATGGCATCAATTCATTGCACTACCGTGTGATCCACTCTGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCACCCAGACCTGCCCGGGGATAAAGCAATGCAC
  5   1   2       bld Eye1      out                   IMAGE:6948693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACCGGTCCGGAATTCCTGCGATTTACCTTCACCCTATACTGAGATTCCAGAAAGTTGCATACGGAATTTACATTATCAATCAGTTTGGCGAGGACACTTTCAATCGGGCCAAGCTATTGAATATTGGTTTTCTGGAAGCAATGAAAGAGGCAGACTATGACTGTTTCATTTTCAGTGATGTGGATCTTATTCCTATGGATGACAGAAATTTATATCATTGCTATGAGCAGCCACGGCATTTTGCCATTGCCATGGACAAGTTTGCATTCCGGTTGCCATATGCAGGCTATTTTGGAGGGGTCTCTGGACTAAGCAAAGCCCAGTTTTTGAAGATAAATGGTTTTCCCAACGAATACTGGGGATGGGGAGGAGAAGACGATGATATTTATAACAGAATAACCCACAATGGCATGAAAATTTCCCGGCCTGATATCCACGTTGGACGTTATCGAATGATCAAACATGAACGAGACAAGCACAATGAGCCCAATCCTCAAAGATTTACAAAGATTCAGAATACGAAGATGACTATGAAGAAAGATGGCATCAATTCATTGCACTACCGTGTGATCCACTCTGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCACCCAGACCTGCCCGGGGATAAAGCAATGCACTCAGCACTTCTCCCGACAGCCTAATTCTTTCCTCCTTTCATTTTGGAAGAAGGAGAAGAAATGCAGTTAAAACTATACTTCTGGCCTCCTCCAGGGGGTTTTTCCCTTTACCGTTTATGTGGGCAGTTTTGCCCTGGTTTCATCTGGTACCCCCACGGAAAGGGACTGGACCTATTTCTTAGTAAAGGAATTAAACCAAGCTCGGGG
  5   1   2       bld Emb4                            IMAGE:5515841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTACAAAGATTCAGAATACGAAGATGACTATGAAGAAAGATGGCATCAATTCATTGCACTACCGTGTGATCCACTCTGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCACCCAGACCTGCCCGGGGATAAAGCAATGCACTCAGCACTTCTCCCGACAGCCTAATTCTTCCTCCTTTCATTTTGGAAGAAGGAGAGGAAATGCAGTTAAAACTATACTTCTGCCTCCTCCAGGGGTTTTTCCATTACCGTTATGTGGCAGTTTGCCTGGTTCATCTGTACACCACGGAAGGACTGACCTATTCTAGTAAAGAATAAACAAACTCGGTGCTCATGAGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGACTTAATCCATCTGCTACATTTTAGTACTTCCTTGTTCTTCttttttttattttttAAATCTTTTATAAAACAACAGATTTTCTTCTCCATTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGTACTATAACCGCTCACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAACATGAATATACTAATAGCCTATAAACTCAAGGTCACTTTGGATGCTAAAATATACACTTTTAATCTTGCCCTGAACACTTGCACTACAGGGCAACAATGAGAGCTAAAACTAATGTAACCGTGCATATCTACTTTAATANGATGCTGCTAAATCATCTAGCCTAGGTACCACTATAACAGTTACAGAGTACTGTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)