Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:7010088.5                       6 END     1          14       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8735968.5                       4 PI      92          1      284                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012785908 Xl3.1-IMAGE:8069573.3 - 7 ESTs
                                                                       .-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8069573.3                                                                        CCAGATGGAACTTACGTGAAGCCACTCAGTGACAAACTGACCTATGGCACAATGGTGTTCATTTGTTCAATGATTGTAGGAGACTCTGCACGCAGCCTTTCCCGTGCCTGTACCATCGCTGTCCGGTATAGTACCGTGAGGCACCAGTCAGAGATCAGAGCTGGCGAGCCAGAGCCCCAAATCCTAGACTTTCAAACTCAGCAATACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTACATGAACCACACTTATCACAGAATCAGCGCTGAAATCCAAGATGGCAATCTGAATGAACTGCCCGAGCTGCATGCCCTTTCTGCGGGCTTGAAAGCCTTCACAACATGGGTAGCCAACGCAGGTATTGAAGAGTGCAGGATGGCATGTGGCGGACACGGATACTCCCGTTGCAGTGGGATACCTGATATCTATGTGACTTTTACCCCTGCATGCACATATGAGGGTGAAAACACAGTGATGATGCTACAAACTGCAAGGTTTTTGGTGAAAAGCTACGAAGCTGTTCTTTCTGGGAAACAACTTGATGGAATGGTGTCATACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCTGTTGCCGGCAGATTCCTTGTCAAGGACATCAATGACATTCAAAATCTGGTGGAGGCCTACAAACAACGAGCTGCTTGGTTAGTTGTGGCTGCTGCCAATAGTGTAAATGCCGACTCAAAACGTGGAAAGCGCAAGGAAGACGCATGGAACAAGAACTCTGTAGATCTGGTCCGAGCTTCAGAGGCCCACTGTCATTATGTGGTTGTGAGACTCTTTGCGGAAAAGTTGTCTGAGGTTCTCGATGTGGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTTTTCTACGCGCTACATGGGATCAGCAAGAACACTGGGGACTTCCTTCAGGCTGGACTTCTGACCGCTCTTCAGGTAAATCAAGTGCAGCAAAGAGTAAAGGATCTGCTGGCAGTAATCCGTCCTAATGCAGTGGCTTTGGTGGATGCCTTTGATTACTCAGACACACAACTGGGATCTGTTCTGGGCAGATATGACGGTAACGTCTATGAGAATATGTTTGAGTGGGCAAAGAAATCACCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTACTTGAAACCACTACAGTCCAAACTATGATCCACCCATCAATTCTGCTGAACCCGAATCTGGAAACACAAAAAGCAGTTCTCTTTTTTTTTGATA
                                                  Xl3.1-CHK-1012699918                                                                              GGAACTTACGTGAAGCCACTCAGTGACAAACTGACCTATGGCACAATGGTGTTCATTTGTTCAATGATTGTAGGAGACTCTGCACGCAGCCTTTCCCGTGCCTGTACCATCGCTGTCCGGTATAGTACCGTGAGGCACCAGTCAGAGATCAGAGCTGGCGAGCCAGAGCCCCAAATCCTAGACTTTCAAACTCAGCAATACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTACATGAACCACACTTATCACAGAATCAGCGCTGAAATCCAAGATGGCAATCTGAATGAACTGCCCGAGCTGCATGCCCTTTCTGCGGGCTTGAAAGCCTTCACAACATGGGTAGCCAACGCAGGTATTGAAGAGTGCAGGATGGCATGTGGCGGACACGGATACTCCCGTTGCAGTGGGATACCTGATATCTATGTGACTTTTACCCCTGCATGCACATATGAGGGTGAAAACACAGTGATGATGCTACAAACTGCAAGGTTTTTGGTGAAAAGCTACGAAGCTGTTCTTTCTGGGAAACAACTTGATGGAATGGTGTCATACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCTGTTGCCGGCAGATTCCTTGTCAAGGACATCAATGACATTCAAAATCTGGTGGAGGCCTACAAACAACGAGCTGCTTGGTTAGTTGTGGCTGCTGCCAATAGTGTAAATGCCGACTCAAAACGTGGAAAGCGCAAGGAAGACGCATGGAACAAGAACTCTGTAGATCTGGTCCGAGCTTCAGAGGCCCACTGTCATTATGTGGTTGTGAGACTCTTTGCGGAAAAGTTGTCTGAGGTTCTCGATGTGGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTTTTCTACGCGCTACATGGGATCAGCAAGAACACTGGGGACTTCCTTCAGGCTGGACTTCTGACCGCTCTTCAGGTAAATCAAGTGCAGCAAAGAGTAAAGGATCTGCTGGCAGTAATCCGTCCTAATGCAGTGGCTTTGGTGGATGCCTTTGATTACTCAGACACACAACTGGGATCTGTTCTGGGCAGATATGACGGTAACGTCTATGAGAATATGTTTGAGTGGGCAAAGAAATCACCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTACTTGAAACCACTACAGTCCAAACTATGATCCACCCATCAATTCTGCTGAACCCGAATCTGGAAACACAAAAAGCAGTTCTCTTTTTTTTTGATAACTACC
                                                      consensus depths                                                                             2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     5     4     5     5     5     5     5     5     5     5     5     3     5     3     5     4     5     3     5     4     5     4     5     5     5     4     5     4     4     3     4     4     4     4     4     4     4     4     4     4     4     2     4     3     3     2     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3
  5   1   1       add Emb4      out                   IMAGE:4203607.5p cacgcgtccgcggncgcgtgggtcgacccacgcgtGCGGAGTATGTGATGATGAAGGACGGCAAGGTTGAGCCAGATGGAACTTACGTGAAGCCACTCAGTGACAAACTGACCTATGGCACAATGGTGTTCATTTGTTCAATGATTGTAGGAGACTCTGCACGCAGCCTTTCCCGTGCCTGTACCATCGCTGTCCGGTATAGTACCGTGAGGCACCANTCAGAGATCAGAGCTGGCGAGCCAGAGCCCCAAATCCTAGACTTTCAAACTCAGCAATACAAGNTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTACATGAACCACACTTATCACAGAATTAGCGCTGAAATCCAAGATGGCAATCTGAATGAACTGCCCGAGCTGCATGCCCTTTTTTGGGGCTTGGAAGCCTTCACAACA
  5   1   2       bld Emb4                   IMAGE:4203607-IMAGp.IMAGp                                    GCGAAGTATATGATGATGAAAGACGCCAAGGTTGAGCCAGATGGAACTTACGTGAAGCCACTCTATGACAAACTGACCTATGGCACAATGGTGTTCATTCGTTCAATGATTGTAGGAGACTCTGCACGCAGCCTTTCCCGTGCCTGTACCATCGCTGTCCGGTATAGTACCGTGAGGCACCAGTCAGAGATCAGAGCTGGCGAGCCAGAGCCCCAAATCCTAGACTTTCAAACTCAGCAATACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTACATGAACCACACTTATCACAGAATCAGCGCTGAAATCCAAGATGGCAATCTGAATGAACTGCCCGAGCTGCATGCCCTTTCTGCGGGCTTGAAAGCCTTCACAACATGGGTAGCCAACGCAGGTATTGAAGAGTGCAGGATGGCATGTGGCGGACACGGATACTCCCGTTGCAGTGGGATACCTGATATCTATGTGACTTTTACCCCTGCATGCACATATGAGGGTGAAAACACAGTGATGATGCTACAAACTGCAAGGTTTTTGGTGAAAAGCTACGAAGCTGTTCTTTCTGGGAAACAACTTGATGGAATGGTGTCATACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCTGTTGCCGGCAGATTCCTTGTCAAGGACATCAATGACATTCAAAATCTGGTGGAGGCCTACAAACAACGAGCTGCTTTGTTAGGTGTGGGCTGCTGCCAATAGTGTAAACGCCGACTCCAAAACGTGGTAAAGCGCAAGGA
  5   1   2       bld FaBN                            IMAGE:8076342.5p                                                                                                                                                                                                                                                                                                                                                                         CTGAAATCCAAGATGGCAATCTGAATGAACTGCCCGAGCTGCATGCCCTTTCTGCGGGCTTGAAAGCCTTCACAACATGGGTAGCCAACGCAGGTATTGAAGAGTGCAGGATGGCATGTGGCGGACACGGATACTCCCGTTGCAGTGGGATACCTGATATCTATGTGACTTTTACCCCTGCATGCACATATGAGGGTGAAAACACAGTGATGATGCTACAAACTGCAAGGTTTTTGGTGAAAAGCTACGAAGCTGTTCTTTCTGGGAAACAACTTGATGGAATGGTGTCATACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCTGTTGCCGGCAGATTCCTTGTCAAGGACATCAATGACATTCAAAATCTGGTGGAGGCCTACAAACAACGAGCTGCTTGGTTAGTTGTGGCTGCTGCCAATAGTGTAAACGCCGACTCAAAACGTGGAAAGCGCAAGGAAGACGCATGGAACAAGAACTCTGTAGATCTGGTCCGAGCTTCAGAGGCCCACTGTCATTATGTGGTTGTGAGACTCTTTGCGGAAAAGTTGTCTGAGGTTCTCGATGTGGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTTTTCTACGCGCTACATGGGATCAGCAAGAACACTGGGGACTTCCTTCAGCTGGACTTCTGACCGCTCTTCAGTAAATCAAGTGCAGCAAAGAGTAAAAGGATCTGCTGGCAGTAAATCCGTCCTAATGCAGTGGGCTTTGGGTGGGATGCCT
  3   1   2       add FaB                             IMAGE:8069573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAGAGTGCAGGATGGCATGTTGGTGGACACGATACTCCGTGCAGTGGGATACTGATATCTATGTGACTTTAACCCGTGCATGCACATATGAGGGTGAAAACACAGTGATGATGCTACAAACTGCAAGGTTTTTGGTGAAAAGCTACGAAGCTGTTCTTTCTGGGAAACAACTTGATGGAATGGTGTCATACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCTGTTGCTGGCCGATTCCTTGTCAAGGACATCAATGACATTCAAAATCTGGTGGAGGCCTACAAACAACGAGCTGCTTGGTTAGTTGTGGCTGCTGCCAATAGTGTAAATGCCGACTCAAAACGTGGAAAGCGCAAGGAAGACGCATGGAACAAGAACTCTGTAGATTTGGTCCGAGCTTCAGAGGCCCACTGTCATTATGTGGTTGTGAGACTCTTTGCGGAAAAGTTGTTTGAGGTTCTCGATGTGGCTGCCCATTGTATTTTGAGCTCTCTCTGCCTTTTTTACGCGCTACATGGGATCAGCAAGAACACTGGGGACTTCCTTCAGGCTGGACTTTTGACCGCTTTTCAGGTAAATCAAGTGCAGCAAAGAGTAAAGGATCTGCTGGCAGTAATCCGTCCTAATGCAGTGGCTTTGGTGGATGCCTTTGATTACTCAGACACACAACTGGGATCTGTTCTGGGCAGATATGACGGTAACGTCTATGAGAATATGTTTGAGTGGGCAAAGAAATCACCGTTGAACAAAACACAGGTGCAAGAATCCTTCCACAAGTACTTGAAACCACTACAGTCCAAACTATGATCCACCCATCAATTTTGCTGAACCCGAATCTGGAAACACAAAAAAGCAGTTCTCTTTTTTTTTTAAACCTTCCCTCCTAAGATAATCTTAATTT
  5   1   2      seed FaBN                            IMAGE:8078749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCATGTGGTGGACACGGATACTCCCGTTGCAGTGGGATACCTGATATCTATGTGACTTTTACCCCTGCATGCACATATGAGGGTGAAAACACAGTGATGATGCTACAAACTGCAAGGTTTTTGGTGAAAAGCTACGAAGCTGTTCTTTCTGGGAAACAACTTGATGGAATGGTGTCATACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCTGTTGCTGGCCGATTCCTTGTCAAGGACATCAATGACATTCAAAATCTGGTGGAGGCCTACAAACAACGAGCTGCTTGGTTAGTTGTGGCTGCTGCCAATAGTGTAAATGCCGACTCAAAACGTGGAAAGCGCAAGGAAGACGCATGGAACAAGAACTCTGTAGATCTGGTCCGAGCTTCAGAGGCCCACTGTCATTATGTGGTTGTGAGACTCTTTGCGGAAAAGTTGTCTGAGGTTCTCGATGTGGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTTTTCTACGCGCTACATGGGATCAGCAAGAACACTGGGGACTTCCTTCAGGCTGGACTTCTGACCGCTCTTCAGGTAAATCAAGTGCAGCAAAGAGTAAAGGATCTGCTGGCAGTAATCCGTCCTAATGCAGTGGCTTTGGTGGATGCCTTTGATTACTCAGACACACNACTGGGATCTGTTCTGGGCAGATATGACGGTAACGTCTATGAGAATATGTTTGAGTGGGCAAAGAATCACCGCTGAA
  5   1   2       bld Int2                            IMAGE:8529568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAACTTGATGGAATGGTGTCATACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCTGTTGCCGGCAGATTCCTTGTCAAGGACATCAATGACATTCAAAATCTGGTGGAGGCCTACAAACAACGAGCTGCTTGGTTAGTTGTGGCTGCTGCCAATAGTGTAAACGCCGACTCAAAACGTGGAAAGCGCAAGGAAGACGCATGGAACAAGAACTCTGTAGATCTGGTCCGAGCTTCAGAGGCCCACTGTCATTATGTGGTTGTGAGACTCTTTGCGGAAAAGTTGTCTGAGGTTCTCGATGTGGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTTTTCTACGCGCTACATGGGATCAGCAAGAACACTGGGGACTTCCTTCAGGCTGGACTTCTGACCGCTCTTCAGGTAAATCAAGTGCAGCAAAGAGTAAAGGATCTGCTGGCAGTAATCCGTCCTAATGCAGTGGCTTTGGTGGATGCCTTTGATTACTCAGACACACAACTGGGATCTGTTCTGGGCAGATATGACGGTAACGTCTATGAGAATATGTTTGAGTGGGCAAAGAAATCACCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTACTTGAAACCACTACAGTCCAAACTATGATCCACCCATCAATTCTGCTGAACCCGAATCTGGNAACACAAAAAGCAGTTCTCtttttttttGATAACTACCCTCGAAGTATAAAACTGTTTTCCTATTTCTGTCAATTATGTTTATTACANGGGGCAAAGCATGTGTAGCAAG
  3   1   2       add Tbd7                                 XL110e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGCTGCCCATCGTATTNTGAGCTCTNTNTGCCTTTTTTACGCGCTACATGGGATCAGCAAGAACACTGGGGACTTCCTTCAGGCTGGACTTNTGACCGCTNTTCAGGTAAATCAAGTGCANCAAANAGTAAAGGATCTGCTGGCAGTAATCCGTCCTAATGCAGTGGCTTTGGTGGATGCCTTTGATTACTCAGACACNCAACTGGGATCTGTTNTGGGCAGATATGACGGTAACGTCTATGAGAATATGTTTGAGTGGGCAAANAAATCNCCGCTGAACAAAACACAGGNGCACGAATCCTTCCACAAGNACTTGAAACCNCTACAGTCCAAACTATGATCCACCCATCAATTCTGCTGAACCCGAATCTGGAAACACAAAAAGCAGTTCTCTTTTTTTTTGATAACCTACCCTCGAAAGTAATAAAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)