Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  1.75    0Xl3.1-IMAGE:8549013.5                      38 END     4          66       10                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6874076.3                       4 PI      100      1289     1428                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6863230.5                       4 PI      93        611     1428                Unknown (protein for MGC:81671) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012785917 Xl3.1-IMAGE:7390476.5 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7390476.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGATCTCCACCAGCACTTCCGCACACACCAGGACCTTTGGCACATGCTACACCCACCGCAACTGCAGCAACTCCTACAATGCAGAACAACCAGCCAGTTGAATTCAACCACGCTATTAACTATGTAAACAAGATCAAGAACCGATTTCAAGGCCAGCCAGACATTTACAAGTCTTTCCTTGAGATTCTGCACACATATCAGAAGGAACAACGCAATGCTAAAGAAGCAGGGGGTAATTACACACCAGCCCTGACCGAGCAGGAGGTCTATGCCCAGGTAGCAAGACTTTTTAAAAACCAGGAGGACCTGTTATCAGAATTTGGCCAATTTTTGCCAGATGCCAACAGCTCTGTGCTTTTGAGCAAAACAACAGCTGAAAAAGTTGAATCTGTAAGAAATGATCACGGGGGCACAGTGAAGAAGCCACAGCTTAACAATAAGCAGCAGAGGCCCAACCAGAATGGCTGCCAAATTAGACGGCACTCTGGAACTGGAGTCACACCCCCAGTTAAGAAGAAACCTAAAATTCTTATTCCTAAAGATCAGTCACTAGCAGATGCCAACAAACATGGAGCAGGAGCAGAATCACAGTTTTTTGACAAGGTCCGTAAAGCACTTCGGAGTGCAGAAGCATATGATAATTTCCTGAGATGCCTGGTGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTCCCAGAGCTATTTACATGGTTAAAAAATTTCTTGGGTTACAAAGAATCCTCCCATCTGGAGAGCTTCCCAAAAGAGCGAGCTACTGAGGGTATTGCCATGGAGATTGACTATGCATCATGTAAGCGTTTGGGGTCAAGTTACCGAGCCTTACCCAAAAGCTTCCAGCAGCCAAAATGCACTGGCAGGACACCGCTATGTAAAGAGGTTTTGAATGACACTTGGGTGTCTTTTCCATCCTGGTCAGAAGACTCAACTTTTGTGAGCTCTAAAAAGACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATTCAGAAGAAACTTTCACGGCTTTCTGCAGAGGACCAGGCCAAATTCAGACTGGACAATGCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGGCTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGTCTAAAGAAAAACCCTGCTGTTGCTGTACCTATTGTCCTAAAGAGATTGAAAATTAAGGAGGAAGAGTGGCGGGAAGCACAGCGTGGGTTTAATAAGATCTGGCGGGAACAGAATGAAAAGTACTATCTTAAATCTCTGGACCATCAGGGTATCAACTACAAACAGATTGATACAAAGGTGTT
                                                  Xl3.1-CHK-1012701340                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCACCAGCACTTCCGCACACACCAGGACCTTTGGCACATGCTACACCCACCGCAACTGCAGCAACTCCTACAATGCAGAACAACCAGCCAGTTGAATTCAACCACGCTATTAACTATGTAAACAAGATCAAGAACCGATTTCAAGGCCAGCCAGACATTTACAAGTCTTTCCTTGAGATTCTGCACACATATCAGAAGGAACAACGCAATGCTAAAGAAGCAGGGGGTAATTACACACCAGCCCTGACCGAGCAGGAGGTCTATGCCCAGGTAGCAAGACTTTTTAAAAACCAGGAGGACCTGTTATCAGAATTTGGCCAATTTTTGCCAGATGCCAACAGCTCTGTGCTTTTGAGCAAAACAACAGCTGAAAAAGTTGAATCTGTAAGAAATGATCACGGGGGCACAGTGAAGAAGCCACAGCTTAACAATAAGCAGCAGAGGCCCAACCAGAATGGCTGCCAAATTAGACGGCACTCTGGAACTGGAGTCACACCCCCAGTTAAGAAGAAACCTAAAATTCTTATTCCTAAAGATCAGTCACTAGCAGATGCCAACAAACATGGAGCAGGAGCAGAATCACAGTTTTTTGACAAGGTCCGTAAAGCACTTCGGAGTGCAGAAGCATATGATAATTTCCTGAGATGCCTGGTGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTCCCAGAGCTATTTACATGGTTAAAAAATTTCTTGGGTTACAAAGAATCCTCCCATCTGGAGAGCTTCCCAAAAGAGCGAGCTACTGAGGGTATTGCCATGGAGATTGACTATGCATCATGTAAGCGTTTGGGGTCAAGTTACCGAGCCTTACCCAAAAGCTTCCAGCAGCCAAAATGCACTGGCAGGACACCGCTATGTAAAGAGGTTTTGAATGACACTTGGGTGTCTTTTCCATCCTGGTCAGAAGACTCAACTTTTGTGAGCTCTAAAAAGACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATTCAGAAGAAACTTTCACGGCTTTCTGCAGAGGACCAGGCCAAATTCAGACTGGACAATGCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGGCTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGTCTAAAGAAAAACCCTGCTGTTGCTGTACCTATTGTCCTAAAGAGATTGAAAATTAAGGAGGAAGAGTGGCGGGAAGCACAGCGTGGGTTTAATAAGATCTGGCGGGAACAGAATGAAAAGTACTATCTTAAATCTCTGGACCATCAGGGTATCAACTACAAACAGATTGATACAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     1     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Ce ---- 2e-027     NP_001122442.1 SIN3 (yeast Switch INdependent) histone deacetylase component homolog family member (sin-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-074     XP_640783.1 paired amphipathic helix (PAH) containing protein [Dictyostelium discoideum AX4] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-105     NP_725189.1 CG8815-PD [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-112     XP_317596.4 AGAP007892-PA [Anopheles gambiae str. PEST] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Xt ---- 1e-153     NP_001072289.1 hypothetical protein LOC779742 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PREDICTED - Sp ---- 9e-170     XP_787530.2 PREDICTED: similar to transcriptional co-repressor Sin3A [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED - Cf ---- 0          XP_535546.2 PREDICTED: similar to transcriptional co-repressor Sin3A [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 0          XP_001334083.1 PREDICTED: similar to transcriptional co-repressor Sin3A [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 0          NP_056292.1 transcriptional co-repressor Sin3A; transcriptional regulator, SIN3A (yeast)[Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 0          NP_001103821.1 transcriptional regulator, SIN3A isoform 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                   PREDICTED - ?? ---- 0          XP_880544.3 PREDICTED: similar to transcriptional regulator, SIN3A isoform 6 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 0          XP_413695.2 PREDICTED: similar to transcriptional co-repressor Sin3A [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN --- Xl ---- 0          NP_001081937.1 transcription co-repressor Sin3 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7390476.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   1       add Emb4                            IMAGE:5515899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGATCTCCACCAGCACTTCCGCACACACCAGGACCTTTGGCACATGCTACACCCACCGCAACTGCAGCAACTCCTACAATGCAGAACAACCAGCCAGTTGAATTCAACCACGCTATTAACTATGTAAACAAGATCAAGAACCGATTTCAAGGCCAGCCAGACATTTACAAGTCTTTCCTTGAGATTCTGCACACATATCAGAAGGAACAACGCAATGCTAAAGAAGCAGGGGGTAATTACACACCAGCCCTGACCGAGCAGGAGGTCTATGCCCAGGTAGCAAGACTTTTTAAAAACCAGGAGGACCTGTTATCAGAATTTGGCCAATTTTTGCCAGATGCCAACAGCTCTGTGCTTTTGAGCAAAACAACAGCTGAAAAAGTTGAATCTGTAAGAAATGATCACGGGGGCACAGTGAAGAAGCCACAGCTTAACAATAAGCAGCAGAGGCCCAACCAGAATGGCTGCCAAATTAGACGGCACTCTGGAACTGGAGTCACACCCCCAGTTAAGAAGAAACCTAAAATTCTTATTCCTAAAGATCAGTCACTAGCAGATGCCAACAAACATGGAGCAGGAGCAGAATCACAGTTTTTTGACAAGGTCCGTAAAGCACTTCGGAGTGCAGAAGCATATGATAATTTCCTGAGATGCCTGGTGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTTCCAGAGCTATTACATGGTTAANAAATTTCTGGGTACA
  5   1   1       add Ga18      out                     xlk128n16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGATCTCCACCAGCACAGCCGCACACACCAGGACCTTTGGCACATGCTACACCCACCGCAACTGCAGCAACTCCTACAATGCAGAACAACCAGCCAGTTGAATTCAACCACGCTATTAACTATGTAAACAAGATCAAGAACCGATTTCAAGGCCAGCCAGACATTTACAAGTCTTTCCTTGAGATTCTGCACACATATCAGAAGGAACAACGCAATGCTAAAGAAGCAGGGGGTAATTACACACCAGCCCTGACCGAGCAGGAGGNCTATGCCCAGGTAGCAAGACTTTTTAAAAACCAGGAGGACCTGTTATCAGAATTTGGCCAATTTTTGCCAGATGCCAACAGCTCTGTGCTTTTGAGCAAAACAACAGCTGAAAAAGTTGAATCTGTAAGAAATGATCACGGGGGCACAGTGAAGAAGCCACAGCTTAACAATAAGCAGCAGAGNNCCAACCAGAATGGCTGCCAAATTAGACGGCACTCTGGAACTGGAGTCACACCCCCAGTTAAGAAGAAANCTAAAATTCTTATTCCTAAAGATCAGTCACTAGCAGANNNCAACAAACATGGAGCAGGAGNAGAATCACAGTTTTTTGACAAGGNCCGTAAAGCACTTCGGAGT
  5   1   2      skin Neu7      out                        XL014m22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAGATNGTCACTAGCAGNATGCCAACAAACATGGAGCAGGAGCAGAATCACAGTTTTTTGACAAGGTCCGTAAAGCACTTCGGAGTGCAGAAGCATATGATAATTTCCTGAGATGCCTGGTGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTCCCAGAGCTATTTACATGGTTAAAAAATTTCTTGGGTTACAAAGAATCCTCCCATCTGGAGAGCTTCCCAAAAGAGCGAGCTACTGAGGGTATTGCCATGGAGATTGACTATGCATCATGTAAGCGTTTGGGGTCAAGTTACCGAGCCTTACCCAAAAGCTTCCAGCAGCCAAAATGCACTGGCAGGACACCGCTATGTAAAGAGGTTTTGAATGACACTTGGGTGTCTTTTCCATCCTGGTCAGAAGACTCAACTTTTGTGAGCTCTAAAAAGACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATT
  5   1   2       bld Ga18                                xlk5a22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTCCCAGAGCTATTTACATGGTTAAAAAATTTCTTGGGTTACAAAGAATCCTCCCATCTGGAGAGCTTCCCAAAAGAGCGAGCTACTGAGGGTATTGCCATGGAGATTGACTATGCATCATGTAAGCGTTTGGGGTCAAGTTACCGAGCCTTACCCAAAAGCTTCCAGCAGCCAAAATGCACTGGCAGGACACCGCTATGTAAAGAGGTTTTGAATGACACTTGGGTGTCTTTTCCATCCTGGTCAGAAGACTCAACTTTTGTGAGCTCTAAAAAGACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATTCAGAAGAAACTTTCACGGCTTTCTGCAGAGGACCAGGCCAAATTCAGACTGGACAATGCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGNTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGNCTAAAGAAAAACCCTGCTGTTGNTGTACCTATTGTCCTAAAGAGANTGAAAATTAAGGAGGAAGAGTGGNGG
  5   1   2       bld Neu7      out                        XL043l08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTTGTGAGCTCTAAAAGNACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATTCAGAAGAAACTTTCACGGCTTTCTGCAGAGGACCAGGCCAAATTCAGACTGGACAATGCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGGCTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGTCTAAAGAAAAACCCTGCTGTTGCTGTACCTATTGTCCTAAAGAGATTGAAAATTAAGGAGGAAGAGTGGCGGGAAGCACAGCGTGGGTTTAATAAGATCTGGCGGGAACAGAATGAAAAGTACTATCTTAAATCTCTGGACCATCAGGGTATCAACTACAAACAGATTGATACAAAGGTGTTTGCGTTCCAAGAGTCTCCTTAATGAGATTGAGAGCATCTATGATGAGCACCAGGAACAAGCTTCAGAAGACAATTCTGGGATCTCTTCTGGCCCACACCTCACACTCACATATGATGACAAACAGATACTGGAAGATGCAGCCCTCACTTATAATCCACCATGTAAAACGACAGACTGGCATACAAAAGGA
  5   1   2      seed Te2       out                   IMAGE:7390476.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGGCTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGTCTAAAGAAAAACCCTGCTGTTGCTGTACCTATTGTCCTAAAGAGATTGAAAATTAAGGAGGAAGAGTGGCGGGAAGCACAGCGTGGGTTTAATAAGATCTGGCGGGAACAGAATGAAAAGTACTATCTTAAATCTCTGGACCATCAGGGTATCAACTACAAACAGATTGATACAAAGGTGTTGCGTTCCAAGAGTCTCCTTAATGAGATTGAGAGCATCTATGATGAGCACCAGGAACAAGCTTCAGAAGACAATTCTGGGATCTCTTCTGGCCCACACCTCACACTCACATATGATGACAAACAGATACTGGAAGATGCAGCCTCACTTATAATCCACCATGTAAAACGACAGACTGGCATACAAAAGGAGGACAAATACAAGATAAAACAGATTGTTTATCACTTCATCCCAGATTTACTTTTTTCGCAGCGGGGGGATCTCTCTGATGTAGAGGAAGAAGAAGAGGAAGAAACAGCTGAGACTGAAGATGGGGTTACAAAAAAACACAATGGGGTTGGTGGCGGTAGTAGTCCTCCAAAGGCTAAGCTGATGTTTGGAATACAGCAGCACAGAAGTGGCGTGGTATGGAGGATTATATAACCTTTTTTATGTGACATAACTGGTACATATCCTCGCTACTCAGATATGTGCTCAGACTCTCGCATTACATCAGCAAGAACAGTGGAGAGAATGAGAAGGNATGGAAGAAGTCTAGACTAGAGACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)