Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  1.75    0Xl3.1-IMAGE:8549013.5                      38 END     4          66       10                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6874076.3                       4 PI      100      1289     1428                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6863230.5                       4 PI      93        611     1428                Unknown (protein for MGC:81671) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012785917 Xl3.1-IMAGE:7390476.5 - 6 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     1     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Ce ---- 2e-027     NP_001122442.1 SIN3 (yeast Switch INdependent) histone deacetylase component homolog family member (sin-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-074     XP_640783.1 paired amphipathic helix (PAH) containing protein [Dictyostelium discoideum AX4] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-105     NP_725189.1 CG8815-PD [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-112     XP_317596.4 AGAP007892-PA [Anopheles gambiae str. PEST] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Xt ---- 1e-153     NP_001072289.1 hypothetical protein LOC779742 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PREDICTED - Sp ---- 9e-170     XP_787530.2 PREDICTED: similar to transcriptional co-repressor Sin3A [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED - Cf ---- 0          XP_535546.2 PREDICTED: similar to transcriptional co-repressor Sin3A [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 0          XP_001334083.1 PREDICTED: similar to transcriptional co-repressor Sin3A [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 0          NP_056292.1 transcriptional co-repressor Sin3A; transcriptional regulator, SIN3A (yeast)[Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 0          NP_001103821.1 transcriptional regulator, SIN3A isoform 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                   PREDICTED - ?? ---- 0          XP_880544.3 PREDICTED: similar to transcriptional regulator, SIN3A isoform 6 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 0          XP_413695.2 PREDICTED: similar to transcriptional co-repressor Sin3A [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN --- Xl ---- 0          NP_001081937.1 transcription co-repressor Sin3 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7390476.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   1       add Emb4                            IMAGE:5515899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGATCTCCACCAGCACTTCCGCACACACCAGGACCTTTGGCACATGCTACACCCACCGCAACTGCAGCAACTCCTACAATGCAGAACAACCAGCCAGTTGAATTCAACCACGCTATTAACTATGTAAACAAGATCAAGAACCGATTTCAAGGCCAGCCAGACATTTACAAGTCTTTCCTTGAGATTCTGCACACATATCAGAAGGAACAACGCAATGCTAAAGAAGCAGGGGGTAATTACACACCAGCCCTGACCGAGCAGGAGGTCTATGCCCAGGTAGCAAGACTTTTTAAAAACCAGGAGGACCTGTTATCAGAATTTGGCCAATTTTTGCCAGATGCCAACAGCTCTGTGCTTTTGAGCAAAACAACAGCTGAAAAAGTTGAATCTGTAAGAAATGATCACGGGGGCACAGTGAAGAAGCCACAGCTTAACAATAAGCAGCAGAGGCCCAACCAGAATGGCTGCCAAATTAGACGGCACTCTGGAACTGGAGTCACACCCCCAGTTAAGAAGAAACCTAAAATTCTTATTCCTAAAGATCAGTCACTAGCAGATGCCAACAAACATGGAGCAGGAGCAGAATCACAGTTTTTTGACAAGGTCCGTAAAGCACTTCGGAGTGCAGAAGCATATGATAATTTCCTGAGATGCCTGGTGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTTCCAGAGCTATTACATGGTTAANAAATTTCTGGGTACA
  5   1   1       add Ga18      out                     xlk128n16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGATCTCCACCAGCACAGCCGCACACACCAGGACCTTTGGCACATGCTACACCCACCGCAACTGCAGCAACTCCTACAATGCAGAACAACCAGCCAGTTGAATTCAACCACGCTATTAACTATGTAAACAAGATCAAGAACCGATTTCAAGGCCAGCCAGACATTTACAAGTCTTTCCTTGAGATTCTGCACACATATCAGAAGGAACAACGCAATGCTAAAGAAGCAGGGGGTAATTACACACCAGCCCTGACCGAGCAGGAGGNCTATGCCCAGGTAGCAAGACTTTTTAAAAACCAGGAGGACCTGTTATCAGAATTTGGCCAATTTTTGCCAGATGCCAACAGCTCTGTGCTTTTGAGCAAAACAACAGCTGAAAAAGTTGAATCTGTAAGAAATGATCACGGGGGCACAGTGAAGAAGCCACAGCTTAACAATAAGCAGCAGAGNNCCAACCAGAATGGCTGCCAAATTAGACGGCACTCTGGAACTGGAGTCACACCCCCAGTTAAGAAGAAANCTAAAATTCTTATTCCTAAAGATCAGTCACTAGCAGANNNCAACAAACATGGAGCAGGAGNAGAATCACAGTTTTTTGACAAGGNCCGTAAAGCACTTCGGAGT
  5   1   2      skin Neu7      out                        XL014m22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAGATNGTCACTAGCAGNATGCCAACAAACATGGAGCAGGAGCAGAATCACAGTTTTTTGACAAGGTCCGTAAAGCACTTCGGAGTGCAGAAGCATATGATAATTTCCTGAGATGCCTGGTGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTCCCAGAGCTATTTACATGGTTAAAAAATTTCTTGGGTTACAAAGAATCCTCCCATCTGGAGAGCTTCCCAAAAGAGCGAGCTACTGAGGGTATTGCCATGGAGATTGACTATGCATCATGTAAGCGTTTGGGGTCAAGTTACCGAGCCTTACCCAAAAGCTTCCAGCAGCCAAAATGCACTGGCAGGACACCGCTATGTAAAGAGGTTTTGAATGACACTTGGGTGTCTTTTCCATCCTGGTCAGAAGACTCAACTTTTGTGAGCTCTAAAAAGACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATT
  5   1   2       bld Ga18                                xlk5a22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATCTTCAATCAAGAAGTAATTTCCCGATCCGAGCTAGTTCACCTGGTGTCCCCATTCCTAGCCAAGTTCCCAGAGCTATTTACATGGTTAAAAAATTTCTTGGGTTACAAAGAATCCTCCCATCTGGAGAGCTTCCCAAAAGAGCGAGCTACTGAGGGTATTGCCATGGAGATTGACTATGCATCATGTAAGCGTTTGGGGTCAAGTTACCGAGCCTTACCCAAAAGCTTCCAGCAGCCAAAATGCACTGGCAGGACACCGCTATGTAAAGAGGTTTTGAATGACACTTGGGTGTCTTTTCCATCCTGGTCAGAAGACTCAACTTTTGTGAGCTCTAAAAAGACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATTCAGAAGAAACTTTCACGGCTTTCTGCAGAGGACCAGGCCAAATTCAGACTGGACAATGCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGNTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGNCTAAAGAAAAACCCTGCTGTTGNTGTACCTATTGTCCTAAAGAGANTGAAAATTAAGGAGGAAGAGTGGNGG
  5   1   2       bld Neu7      out                        XL043l08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTTGTGAGCTCTAAAAGNACACAGTATGAGGAACACATTTACCGATGCGAAGATGAAAGATTTGAGTTGGACGTGGTATTGGAAACAAACCTGGCTACCATTCGTGTTTTGGAAACTATTCAGAAGAAACTTTCACGGCTTTCTGCAGAGGACCAGGCCAAATTCAGACTGGACAATGCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGGCTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGTCTAAAGAAAAACCCTGCTGTTGCTGTACCTATTGTCCTAAAGAGATTGAAAATTAAGGAGGAAGAGTGGCGGGAAGCACAGCGTGGGTTTAATAAGATCTGGCGGGAACAGAATGAAAAGTACTATCTTAAATCTCTGGACCATCAGGGTATCAACTACAAACAGATTGATACAAAGGTGTTTGCGTTCCAAGAGTCTCCTTAATGAGATTGAGAGCATCTATGATGAGCACCAGGAACAAGCTTCAGAAGACAATTCTGGGATCTCTTCTGGCCCACACCTCACACTCACATATGATGACAAACAGATACTGGAAGATGCAGCCCTCACTTATAATCCACCATGTAAAACGACAGACTGGCATACAAAAGGA
  5   1   2      seed Te2       out                   IMAGE:7390476.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACTTGGAGGAACATCTGAGGTCATCCACCGCAAGGCTTTACAGAGGATATATGCGGACAAAGCTGCTGATATTATAGATGGTCTAAAGAAAAACCCTGCTGTTGCTGTACCTATTGTCCTAAAGAGATTGAAAATTAAGGAGGAAGAGTGGCGGGAAGCACAGCGTGGGTTTAATAAGATCTGGCGGGAACAGAATGAAAAGTACTATCTTAAATCTCTGGACCATCAGGGTATCAACTACAAACAGATTGATACAAAGGTGTTGCGTTCCAAGAGTCTCCTTAATGAGATTGAGAGCATCTATGATGAGCACCAGGAACAAGCTTCAGAAGACAATTCTGGGATCTCTTCTGGCCCACACCTCACACTCACATATGATGACAAACAGATACTGGAAGATGCAGCCTCACTTATAATCCACCATGTAAAACGACAGACTGGCATACAAAAGGAGGACAAATACAAGATAAAACAGATTGTTTATCACTTCATCCCAGATTTACTTTTTTCGCAGCGGGGGGATCTCTCTGATGTAGAGGAAGAAGAAGAGGAAGAAACAGCTGAGACTGAAGATGGGGTTACAAAAAAACACAATGGGGTTGGTGGCGGTAGTAGTCCTCCAAAGGCTAAGCTGATGTTTGGAATACAGCAGCACAGAAGTGGCGTGGTATGGAGGATTATATAACCTTTTTTATGTGACATAACTGGTACATATCCTCGCTACTCAGATATGTGCTCAGACTCTCGCATTACATCAGCAAGAACAGTGGAGAGAATGAGAAGGNATGGAAGAAGTCTAGACTAGAGACA

In case of problems mail me! (