Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL518k11ex.3.5                       33 END     1          12        3                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:7393530.5                       7 END     1          12       14                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012786192 Xl3.1-IMAGE:7981618.5 - 8 ESTs
                                                                       .........-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7981618.5                                                                                ATATTGGCTACAGCTTCACATAAAAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCGGCCTATCTAGGCACCAGTGTGGTGCAGAATCAAACACCCTTTGAGCTCAGAAACTCCAAAGTGGTCTCTCAGTCCACCATGAAGATCGAGATGCTTCCGGCCCTCACCGACAACTACATGTACCTGCTCATCGACGAGGAGAGCAAAGAGGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTGAAGAAACATGGAGTTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGTGGAAATGAGAAACTTGTGAAGATGGTGTCTGGTGTAAAAGTATACGGAGGGGACAGCAGAATCGGGGCACTAACACAGAAAGTATCCCATCTAACCACGTTCCAGGTGGGGTCACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGTCGGGGCACATCTGTTACTATGTCACAAAGCCAAACAGCACAGAGCCGCCAGCTCTATTCACAGGTGACACCCTCTTTGTAGCAGGATGCGGGAAGTTCTTCGAAGGAACAGCGGAGGAGATGTACGCAGCTTTGATTGAGGTTTTAGGCCGCCTCCCCCCTCAAACGAGAGTCTACTGCGGTCATGAGTACACCATCAACAATCTCAAATTCGCTCGGCACGTGGAACACAACTATGACGCCATAAAGCAAAAGTTGGCTTGGGCGAAGGAGACTTACAACCACGGAGAACCTACTATTCCTTCTACACTTGCCGAAGAATTTACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCTGTGCAGGAACATGCTGGAGAACAAGACCCCATCTCTACAATGGGAGCAATCCGTAAGGAAAAGGATAATTTCAAGCCCTCAGCTTCCCGGCTCTAGTAACAACTGCCAGTTCCTTCTATAAAATGACTCGACTTCTGCAAGGTGTCCGTCTCTTCAATCCTCAAGTAACTGCCAGTCTTACCCATAATCCAAGAGGACCTGGATGCTGCCAGAAAGAATACAACTATGGATAATTCATCTACCCATTCATTTCACTGGAAATATATTTGTTATTTGATTTTGTCATATCATAATAGTTTGTGAATT
                                                  Xl3.1-CHK-1012698412                                                                                      GCTACAGCTTCAxxxxxxAGGAGAAxTxxxxxGTGxGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCGGCCTATCTAGGCACCAGTGTGGTGCAGAATCAAACACCCTTTGAGCTCAGAAACTCCAAAGTGGTCTCTCAGTCCACCATGAAGATCGAGATGCTTCCGGCCCTCACCGACAACTACATGTACCTGCTCATCGACGAGGAGAGCAAAGAGGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTGAAGAAACATGGAGTTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGTGGAAATGAGAAACTTGTGAAGATGGTGTCTGGTGTAAAAGTATACGGAGGGGACAGCAGAATCGGGGCACTAACACAGAAAGTATCCCATCTAACCACGTTCCAGGTGGGGTCACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGTCGGGGCACATCTGTTACTATGTCACAAAGCCAAACAGCACAGAGCCGCCAGCTCTATTCACAGGTGACACCCTCTTTGTAGCAGGATGCGGGAAGTTCTTCGAAGGAACAGCGGAGGAGATGTACGCAGCTTTGATTGAGGTTTTAGGCCGCCTCCCCCCTCAAACGAGAGTCTACTGCGGTCATGAGTACACCATCAACAATCTCAAATTCGCTCGGCACGTGGAACACAACTATGACGCCATAAAGCAAAAGTTGGCTTGGGCGAAGGAGACTTACAACCACGGAGAACCTACTATTCCTTCTACACTTGCCGAAGAATTTACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCTGTGCAGGAACATGCTGGAGAACAAGACCCCATCTCTACAATGGGAGCAATCCGTAAGGAAAAGGATAATTTCAAGCCCTCAGCTTCCCGGCTCTAGTAACAACTGCCAGTTCCTTCTATAAAATGACTCGACTTCTGCAAGGTGTCCGTCTCTTCAATCCTCAAGTAACTGCCAGTCTTACCCATAATCCAAGAGGACCTGGATGCTGCCAGAAAGAATACAACTATGGATAATTCATCTACCCATTCATTTCACTGGAAATATATTTGTTATTTGATTTTGTCATATCATAATAGTTTG
                                                      consensus depths                                                                                     2     3     2     4     2     4     3     5     3     5     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     5     3     5     4     5     4     5     3     4     3     6     4     6     2     6     3     6     3     5     3     5     2     5     2     4     2     4     2     4     3     4     2     4     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     165     175                                                                                
                                               BLH MIN      27     144                                                                                
                                               BLH MPR       9     144                                                                                
                                               BLH OVR     165     155                                                                                
                                               ORF LNG     165      10                                                                                
                                                                                                                                                                                                                                                                                                                        PROTEIN -== Ce ==== 3e-064     NP_496556.1 Hydroxyacylglutathione hydrolase (28.9 kD) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PROTEIN === At ==== 5e-076     NP_187696.1 hydroxyacylglutathione hydrolase, cytoplasmic / glyoxalase II (GLX2-2) [Arabidopsis thaliana] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PROTEIN === Os ==== 3e-077     NP_001050016.1 Os03g0332400 [Oryza sativa (japonica cultivar-group)] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Xt ==== 9e-079     NP_001120090.1 hypothetical protein LOC100145102 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 2e-088     NP_730569.1 CG4365-PB [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Sp ==== 1e-095     XP_001191822.1 PREDICTED: similar to hydroxyacyl glutathione hydrolase [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 7e-123     NP_077246.1 hydroxyacyl glutathione hydrolase; glyoxylase 2; glyoxalase II; round spermatidprotein RSP29 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 2e-127     NP_956337.1 hypothetical protein LOC336977 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PREDICTED - Cf ---- 4e-128     XP_537013.2 PREDICTED: similar to hydroxyacyl glutathione hydrolase [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN --- Hs ---- 6e-129     NP_005317.2 hydroxyacyl glutathione hydrolase isoform 1 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                           PREDICTED - Bt ---- 4e-130     NP_001030351.1 hypothetical protein LOC509274 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN --- Gg ---= 5e-137     NP_001012807.1 hydroxyacyl glutathione hydrolase [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 3e-148     NP_001089873.1 hypothetical protein LOC734940 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7981618.5                                                                                                                       TGA---------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------TAGTAA------------------------TGA---------------------------------------TAA---------------------------------------------------------ATG------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Em10 5g                         IMAGE:7983344.5p GGAGATCTCGTAGTCATAGCTGCCTGCAGCTTACTTGATATTTGTTTGAAAACAACTCGGTCTTGCCTTACATAGATTAATATTGGCTACAGCTTCACATAAAGGGACCACTAGCGCGTGAGAGACAGAAAATCCCCTGCGGATACTTTCCTTAGTCTTCTGCTCGGCCTATCTAGGCACCAGTGTGGTGCAGAATCAAACACCCTTTGAGCTCAGAAACTCCAAAGTGGTCTCTCAGTCCACCATGAAGATCGAGATGCTTCCGGCCCTCACCGACAACTACATGTACCTGCTCATCGACGAGGAGAGCAAAGAGGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTGAAGAAACATGGAGTTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGTGGAAATGAGAAACTTGTGAAGATGGTGTCTGGTGTAAAAGTATACGGAGGGGACAGCAGAATCGGGGCACTAACACAGAAAGTATCCCATCTAACCACGTTCCAGGTGGGGTCACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGTCGGGGCACATCTGTTACTATGTCACAAAGCCCAACAGCACAGAGCCGCCAGCTCTATTCACAGGTGACAACCTCTTTGTAGCATGATGCGGGAAGTTCTTCAAAAGGACAGCGGAGGAGATGTACGCAGCTTTGATTGAAGTTTTAGGCCGCCTCCCCCCTCAAACGAGAGTTTCTGCTGGTCTGAGTACCCATCTACAATG
  5   1   2      seed Em10 5g                         IMAGE:7979617.5p                                                                    CAGCCCCGCCTCTTCACGATGATGCTGTTTGGGTGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCGGCCTATCTAGGCACCAGTGTGGTGCAGAATCAAACACCCTTTGAGCTCAGAAACTCCAAAGTGGTCTCTCAGTCCACCATGAAGATCGAGATGCTTCCGGCCCTCACCGACAACTACATGTACCTGCTCATCGACGAGGAGAGCAAAGAGGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTGAAGAAACATGGAGTTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGTGGAAATGAGAAACTTGTGAAGATGGTGTCTGGTGTAAAAGTATACGGAGGGGACAGCAGAATCGGGGCACTAACACAGAAAGTATCCCATCTAACCACGTTCCAGGTGGGGTCACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGTCGGGGCACATCTGTTACTATGTCACAAAGCCAAACAGCACAGAGCCGCCAGCTCTATTCACAGGTGACACCCTCTTTGTAGCAGGATGCGGGAAGTTCTTCGAAGGAACAGCGGAGGAGATGTACGCAGCTTTGATTGAGGTTTTAGGCCGCCTCCCANCTCAAACGAGAGTCTACTGCNGTCATGAGTCACCATCAACATCTCAAATCGCTCGGCCGTGGAACAAANATGACGCCTAAGCAAAGTTGCTGGGCAANGAACTACACAACGAGACCTACTATCTCTCACTGCGAGAATAA
  5   1   2       bld Em10 5g   out                   IMAGE:7981618.5p                                                                               TATATTGGCTACAGCTTCACATAAAGGAACCACTAGCGCGTGAGAGACAGAAAATCCCCTGCGGATACTTTCCTTAGTCTTCTGCTCGGCCTATCTAGGCACCAGTGTGGTGCAGAATCAAACACCCTTTGAGCTCAGAAACTCCAAAGTGGTCTCTCAGTCCACCATGAAGATCGAGATGCTTCCGGCCCTCACCGACAACTACATGTACCTGCTCATCGACGAGGAGAGCAAAGAGGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTGAAGAAACATGGAGTTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGTGGAAATGAGAAACTTGTGAAGATGGTGTCTGGTGTAAAAGTATACGGAGGGGACAGCAGAATCGGGGCACTAACACAGAAAGTATCCCATCTAACCACGTTCCAGGTGGGGTCACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGTCGGGGCACATCTGTTACTATGTCACAAAGCCAAACAGCACAGAGCCGCCAGCTCTATTCACAGGTGACACCCTCTTTGTAGCAGGATGCGGGAAGTTCTTCGAAGGAACAGCGGAGGAGATGTACGCAGCTTTGATTGAGGTTTTAGGCCGCCTCCCACCTCAAACGAGAGTCTACTGCGGTCATGAGTACACCATCAACAATCTCAAATTCGCTCGGCACGTGGAACAAACAATGACGC
  5   1   2       add Te1  5x                         IMAGE:6929258.5p                                                                                        GGGGCTGTTTGGGTGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCGGCCTATCTAGGCACCAGTGTGGTGCAGAATCAAACACCCTTTGAGCTCAGAAACTCCAAAGTGGTCTCTCAGTCCACCATGAAGATCGAGATGCTTCCGGCCCTCACAGACAACTACATGTACCTGCTCATCGACGAAGGGAGCAAAGAGGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTGAAGAAACATGGAGTTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGTGGAAATGAGAAACTTGTGAAGATGGTGTCTGGTGTAAAATTATGGAGGGGACAGCAGATCGGGGCCTAACACAGAAAGTATCCCATCTAACCCGTTCCGGTGGGGTCACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGTCGGGGCACATCTGTTACTATGTCACAAAGCCAAACAGCACAGAGCCGCCAGCTCTATTCACACGTGACACCCTCTTTGTAGCAGGATGCGGGGAGTTTCTCGAAGGAACAGCGGAAGAGATGTACGCAGCTTTGATTGAGGTTTTAGGCCGCCTCCACCTCANACGAGAGTCTACTGCNGTCATGAGTACACCATCAACAATCTCAAATTCGCTCGGCACGTGGAACCCAACATGACGCNTTATAGCAAAAATTGGCTTGGGCGAAAGAGACTTACAACAACGGAGAACCTACTATTCCTTCTAACCTGCCGGAAAAATAACATTAAACCCTTTTATGAAAGTGAAAAAGAATTCTGTGCAGAACATGA
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db25g11.y1                                                                                                                   GTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCGGCCTATCTAGGCACCAGTGTGGTGCAGAATCAAACACCCTTTGAGCTCAGAAACTCCAAAGTGGTCTCTCAGTCCACCATGAAGATCGAGATGCTTCCGGCCCTCACCGACAACTACATGTACCTGCTCATCGACGAGGAGAGCAAAGAGGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTGAAGAAACATGGAGTTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGTGGAAATGAGAAACTTGTGAAGATGGTGTCTGGTGTAAAAGTATACGGAGGGGACAGCAGAATCGGGGCACTAACACAGAAAGTATCCCATCTAACCACGTTCCAGGTGGGGTCACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGTCGGGGCACATCTGTTACTATGTCACAAAGCCAAACAGCACAGAGCCCGCAGCTCTATTCACAGGTGACACCCTCTTTGTAGCAGGATGCGGGAAGTTC
  5   1   2       add Egg6      out                   IMAGE:4435604.5p                                                                                                                                                                                                                                                       GAAAATCGAGATGCTTCCGGCCCTCACAGACGACTACATGTACCTGCTCATCGACGAAGGGAGCAAAGACGCAGCTATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTTGACGCAGTGAAGAAACATGGAGGTAAACTGACCACTGTCCTCACCACACACCATCACTGGGATCATGCTGGCGGAAATGAGAAACTTGTGAAGATGGTGTCTGGAGTAAAAGTATATGGAGGGGACAGCAGAATCGGGGCACTAACACAGAAAGTATCCCATCTAACCACGTACCAGGTGGGGACACTCCATGTGAAATGTCTCTATACCCCGTGTCACACGACGGGGCACATCTGTTACTATGTCACAAAGCCAAACAGCACAGAGCCGCCAGCTCTATTCACAGGTGACACCCTCTTTGTACCAGGATGCGGGAAGGTCTTCCAAGGAACAGCGGAGGAGATGCACGCAGCTCTGATT
  3   1   1       add Ooc1 5g3  in                     Ooc1-db25g11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCCGCCTCCCCCCTCAAACGAGAGTCGACCCGGGTCATGAGTACATCATCAACAATCTCCAATTCGCTCGGCACGTGGAACACAACTATGACGCCATAAAGCAAAAGTTGGCTTGGGCGAAGGAGACTTACAACCACGGAGAACCTACTATTCCTTCTACACTTGCCGAAGAATTTACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCTGTGCAGGAACATGCTGGAGAACAAGACCCCATCTCTACAATGGGAGCAATCCGTAAGGAAAAGGATAATTTCAAGCCCTCAGCTTCCCGGCTCTAGTAACAACTGCCAGTTCCTTCTATAAAATGACTCGACTTCTGCAAGGTGTCCGTCTCTTCAATCCTCAAGTAACTGCCAGTCTTACCCATAATCCAAGAGGACCTGGATGCTGCCAGAAAGAATACAACTATGGATAATTCATCTACCCATTCATTTCACTGGAAATATATTTGTTATTTGATTTTGTCATATCATAATAGTTTGTGAATTCTAATTTGCCAATTGCAATGTATCTGTGAAAAATGCTTTCCTAATAAACTGGCTTCCAAATTGTTGAAAAAAAAAAAAAAACAAAAAAAAAA
  3   1   1       add Neu7                                 XL001b19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCTCCCACCTCAAACGAGAGTNTACTGCGGGTCATGAGTACACCATCAACAATCTCAAATTCGCTCGGCACGTGGAACCAAACAATGACGCCATAAAGCAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAACGGAGAACCTACTATTCCTTCTACACTTGCCGAAGAATTTACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCTGTGCAGGAACATGCTGGAGAACAAGACCCCATCTCTACAATGGGAGCAATCCGTAAGGAAAAGGATAATTTCAAGCCCTCAGCTTCCCGGCTCTAGTAACAACTGCCAGTTCCTTCTATAAAATGACTCGACTTCTGCAAGGTGTCCGTCTCTTCAATCCTCAAGTAACTGCCAGTCTTACCCATAATCCAAGAGGACCTGGATGCTGCCAGAAAGAATACAACTATGGATAATTCATCTACCCATTCATTTCACTGGAAATATATTTGTTATTTGATTTTGTCATATCATAATAGTTTGTGAATTNCTAATTTGCCAATTGCAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)