Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL189n03.5                            8 PI      94          2      238                nodal related 3, TGF-beta related growth factor [Xenopus laevis]
     2   0.0    0Xl3.1-XL185d18.3                            7 PI      96        387      840                nodal related 3, TGF-beta related growth factor [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012786349 Xl3.1-IMAGE:3749303-IMAGp.5 - 2 ESTs
                                                                       .......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3749303-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTATTCATGGGATCATTTAAGACCAAGCCTTCTGCTGCTCTAGATGCTGACTGCAAGGTCTTCAATCTCACCATTTTGCTGCAGAACTTTCTGACCAGGGGAAAGAGGTTAATAAAGGATGAATACATACAGGCAAAAGGTCTCCATCTGAAAGATCTAGAGAAGAGTGCCACAGAAAAAGGAACAGAAAATGTAGATACATTGAAGCAAGATCAATATCACGTATCTGACTTTGCTGCAGAGAGAATAATGCTGGTTGTGTTTGCTAAAGAACAGTCTCATGCTAAACCTGATCCCCCCAGTCTTGGCAAAAAGCTATTCCCTTCAAAGTATGGTATTGATGATAATGCCAACAAGGTGAATGGATTTCGGAGACTTAGAAGGAACAAGAAAGAGAAAACACAAATCCATGTGAGCACCGGTCCACCTAAACCTATTGAAGAGATCAAACCCAAGTGCAAGAAGGTGGACATGTTTGTGGACTTTCAGAAGATGGGATGGGGCAGCTGGATTGTTTACCCCAAGGCATATAATGCATATAGATGTGAATCCACCTGTGCAGTTCCACTGAATGAGACAGAGAATGCAACAAACCATTCCTACATTAAGAGTTTGCTCCCTCTGAGTGACATGGAGAGAAAAGAGTGTCCCTCCTGTGTCCCCGTGAAGATGATGTCCATGTCAATGTTGTACTATGAGAATGAAGATTTTATCCTGAGGGCACCATGAAGAGATGATTGTAGAAGAATGTGGATTTCAAGGACATGTAACACTGACTGTCTCCTAAACTTTTCTTACTACATCCAACCAACTACATCGTTTCTTGGATTCCTTATT
                                                  Xl3.1-CHK-1012716864                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCATGGGATCATTTAAGACCAAGCCTTCTGCTGCTCTAGATGCTGACTGCAAGGTCTTCAATCTCACCATTTTGCTGCAGAACTTTCTGACCAGGGGAAAGAGGTTAATAAAGGATGAATACATACAGGCAAAAGGTCTCCATCTGAAAGATCTAGAGAAGAGTGCCACAGAAAAAGGAACAGAAAATGTAGATACATTGAAGCAAGATCAATATCACGTATCTGACTTTGCTGCAGAGAGAATAATGCTGGTTGTGTTTGCTAAAGAACAGTCTCATGCTAAACCTGATCCCCCCAGTCTTGGCAAAAAGCTATTCCCTTCAAAGTATGGTATTGATGATAATGCCAACAAGGTGAATGGATTTCGGAGACTTAGAAGGAACAAGAAAGAGAAAACACAAATCCATGTGAGCACCGGTCCACCTAAACCTATTGAAGAGATCAAACCCAAGTGCAAGAAGGTGGACATGTTTGTGGACTTTCAGAAGATGGGATGGGGCAGCTGGATTGTTTACCCCAAGGCATATAATGCATATAGATGTGAATCCACCTGTGCAGTTCCACTGAATGAGACAGAGAATGCAACAAACCATTCCTACATTAAGAGTTTGCTCCCTCTGAGTGACATGGAGAGAAAAGAGTGTCCCTCCTGTGTCCCCGTGAAGATGATGTCCATGTCAATGTTGTACTATGAGAATGAAGATTTTATCCTGAGGGCACCATGAAGAGATGATTGTAGAAGAATGTGGATTTCAAGGACATGTAACACTGACTGTCTCCTAAACTTTTCTTACTACATCCAACCAACTACATCGTTTCTTGGATTCCTTATTTATGCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 5e-015     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Dm ---- 4e-015     NP_477340.1 glass bottom boat CG5562-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 7e-018     XP_874937.3 PREDICTED: similar to bone morphogenetic protein 6 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 7e-022     NP_038639.1 nodal; early embryo mesoderm formation; transgenic lethal 413.d [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN --- Sp ---- 5e-022     NP_001091919.1 nodal [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Cf ---- 4e-022     XP_546146.2 PREDICTED: similar to Nodal homolog precursor [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 3e-022     NP_060525.2 mouse nodal homolog precursor [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 2e-022     NP_001072000.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Bt ---- 1e-022     XP_609225.2 PREDICTED: similar to Nodal homolog precursor [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 2e-036     XP_424385.1 PREDICTED: similar to nodal-related protein 1 precursor [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 1e-041     NP_851298.1 southpaw [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 2e-123     Q800C0.1 Nodal homolog 3-A precursor (Nodal-related protein 3-A) (Xtnr3-A) [Xenopus tropicalis]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xl ---- 3e-141     Q91621.2 Nodal homolog 3-B precursor (Nodal-related protein 3-B) (Xnr3-B) (Fugacin) [Xenopus laevis]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3749303-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATGATG---ATG---ATG---------------------------------------TGA------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2      seed Gas7                   IMAGE:3749303-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTATTCATGGGATCATTTAAGACCAAGCCTTCTGCTGCTCTAGATGCTGACTGCAAGGTCTTCAATCTCACCATTTTGCTGCAGAACTTTCTGACCAGGGGAAAGAGGTTAATAAAGGATGAATACATACAGGCAAAAGGTCTCCATCTGAAAGATCTAGAGAAGAGTGCCACAGAAAAAGGAACAGAAAATGTAGATACATTGAAGCAAGATCAATATCACGTATCTGACTTTGCTGCAGAGAGAATAATGCTGGTTGTGTTTGCTAAAGAACAGTCTCATGCTAAACCTGATCCCCCCAGTCTTGGCAAAAAGCTATTCCCTTCAAAGTATGGTATTGATGATAATGCCAACAAGGTGAATGGATTTCGGAGACTTAGAAGGAACAAGAAAGAGAAAACACAAATCCATGTGAGCACCGGTCCACCTAAACCTATTGAAGAGATCAAACCCAAGTGCAAGAAGGTGGACATGTTTGTGGACTTTCAGAAGATGGGATGGGGCAGCTGGATTGTTTACCCCAAGGCATATAATGCATATAGATGTGAATCCACCTGTGCAGTTCCACTGAATGAGACAGAGAATGCAACAAACCATTCCTACATTAAGAGTTTGCTCCCTCTGAGTGACATGGAGAGAAAAGAGTGTCCCTCCTGTGTCCCCGTGAAGATGATGTCCATGTCAATGTTGTACTATGAGAATGAAGATTTTATCCTGAGGGCACCATGAAGAGATGATTGTAGAAGAATGTGGATTTCAAGGACATGTAACACTGACTGTCTCCTAAACTTTTCTTACTACATCCAACCAACTACATCGTTTCTTGGATTCCTTATTTATGCCA
  5   1   2       bld Gas5                            IMAGE:3749303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATCATTTAAGACCAAGCCTTCTGCTGCTCTAGATGCTGACTGCAAGGTCTTCAATCTCACCATTTTGCTGCAGAACTTTCTGACCAGGGGAAAGAGGTTAATAAAGGATGAATACATACAGGCAAAAGGTCTCCATCTGAAAGATCTAGAGAAGAGTGCCACAGAAAAAGGAACAGAAAATGTAGATACATTGAAGCAAGATCAATATCACGTATCTGACTTTGCTGCAGAGAGAATAATGCTGGTTGTGTTTGCTAAAGAACAGTCTCATGCTAAACCTGATCCCCCCAGTCTTGGCAAAAAGCTATTCCCTTCAAAGTATGGTATTGATGATAATGCCAACAAGGTGAATGGATTTCGGAGACTTAGAAGGAACAAGAAAGAGAAAACACAAATCCATGTGAGCACCGGTCCACCTAAACCTATTGAAGAGATCAAACCCAAGTGCAAGAAGGTGGACATGTTTGTGGACTNTCAGAAGATGGGATGGGGCAGCTGGATTGTTTACCCCAAGGCATATAATGCATATAGATGTGAATCCACCTGTGCAGTTCCACTGAATGAGACAGAGAATGCAACAAACCATTCCTACATTAAGAGTTTGCTCCCTCTGAGTGACATGGAGAAGAAAGAGTGTCCCCTCTGTGTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)