Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012786536 Xl3.1-IMAGE:8071175.5 - 6 ESTs
                                                                       .....-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8071175.5                                                                                                                                                                                                                                                                                                                  GGCAGTATTACAGGGACACAGCCAGGAGGAGCTCAGGGTGCTAAGAAGTGGAGTCTGCTCCTTAAGACAATGGTGATGCTACAATCACAGGCTGAGGAGCCTTGGATCCCGGCTAACTGCCTGCAATCAACATGGCAACTCCCAGTCTGGAGGCACAGCCTGCACCCTGTCTTACACCCAGCAGGCACATGAGAGGCATCGGGTTATGGCGCCGTCCTGCCGATTCCTGGGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCTCGGCTATAGGAGCAGCGGAGGGGACAGAGCACGGAATTCCTTTTTTCCTATTGCACCGGGGAGGCCAGACCATGTGGAAAGTCAGCTGTTTGGTAACGGGATTCCTCCTCATCCTCACAGTCACCAGCACCCCCGCTGCAGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCCGCTGGGCACCCTGGCACCGTGTCAGTTACTCAGTCCTTTGTCCAGCCGGTACACAGCCCTATTATGACTCTGTGTGAGGGGCATAGGATCTGCAGTACGTACAGAACGACCTACAAGGTTTCCTACCGTCAAGTCTCCAGGAGAACATCCTTCCCCCTTTACTCTTGCTGCCCCGGCTGGAGAAGAATCGGGGCGCAAACTCACAGTTGCGGCCAAGCTCTGTGCCGATTGCAATGTCAGAACGGAGGGACTTGCGTCAGGTCTAATAAGTGTGAATGTCCAGCTGGATGGAGAGGGATTCATTGCCAGATGTATGTGGACGAGTGCAGTGATGGCACCCATCA
                                                  Xl3.1-CHK-1012702623                                                                                                                                                                                                                                                                                                                        ATTACAGGGACACAGCCAGGAGGAGCTCAGGGTGCTAAGAAGTGGAGTCTGCTCCTTAAGACAATGGTGATGCTACAATCACAGGCTGAGGAGCCTTGGATCCCGGCTAACTGCCTGCAATCAACATGGCAACTCCCAGTCTGGAGGCACAGCCTGCACCCTGTCTTACACCCAGCAGGCACATGAGAGGCATCGGGTTATGGCGCCGTCCTGCCGATTCCTGGGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCTCGGCTATAGGAGCAGCGGAGGGGACAGAGCACGGAATTCCTTTTTTCCTATTGCACCGGGGAGGCCAGACCATGTGGAAAGTCAGCTGTTTGGTAACGGGATTCCTCCTCATCCTCACAGTCACCAGCACCCCCGCTGCAGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCCGCTGGGCACCCTGGCACCGTGTCAGTTACCCAGTCCTTTGTCCAGCCGGTACACAGCCCTATTATGACTCTGTGTGAGGGGCATAGGATCTGCAGTACGTACAGAACGACCTACAAGGTTTCCTACCGTCAAGTCTCCAGGAGAACATCCTTCCCCCTTTACTCTTGCTGCCCCGGCTGGAGAAGAATCGGGGCGCxxACTCACAGCTGCGGCCAAGCTCTGTGCCGATTGCAATGTCAGAACGGAGGGACTTGCGTCAGGTCTAATAAGTGTGAATGTCCAGCTGGATGGAGAGGGATTCATTGCCAGATGTATGTGGACGAGTGCAGTGATGGCACCCATCAGTGTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                       2     2     3     3     3     3     3     3     3     3     3     3     3     5     3     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     5     6     5     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     5     4     5     5     5     4     5     4     4     3     3     3     3     2     3     3     3     3     3     2     2     2     2     2     2     2     2
                                               BLH ATG     340     127                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     340      50                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     340     319                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     340       8                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 6e-010     XP_873582.3 PREDICTED: similar to EGF-like-domain, multiple 3 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ag ---- 2e-010     XP_315695.4 AGAP005682-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-014     NP_788461.1 CG7447-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 7e-021     XP_001184058.1 PREDICTED: similar to EGF-like-domain, multiple 7 [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Bt ==== 1e-034     NP_001071506.1 EGF-like-domain, multiple 7 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ==== 9e-036     NP_001035475.1 hypothetical protein LOC678640 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 7e-036     NP_942018.1 vascular endothelial statin isoform 2 precursor [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Cf ---- 2e-036     XP_548371.2 PREDICTED: similar to EGF-like-domain, multiple 7 isoform 1 [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 9e-037     NP_958854.1 EGF-like-domain, multiple 7 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Gg ==== 2e-040     XP_415421.2 PREDICTED: similar to Egfl7 protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 5e-074     NP_001072909.1 EGF-like-domain, multiple 7 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Xl ==== 9e-084     NP_001104187.1 hypothetical protein LOC100126603 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8071175.5                                                                                                                                                                                                                                                                                                                                                                                           TGA---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2      seed Sp1  5x3  out                   IMAGE:4963143.5p                                                                                                                                                                                                                                                                                                  CACGCGTCCGTTGAGTGGCAGTATTACAGGGACACAGCCAGGAGGAGCTCAGGGTGCTAAGAAGTGGAGTCTGCTCCTTAAGACAATGGTGATGCTACAATCACAGGCTGAGGAGCCTTGGATCCCGGCTAACTGCCTGCAATCAACATGGCAACTCCCAGTCTGGAGGCACAGCCTGCACCCTGTCTTACACCCAGCAGGCACATGAGAGGCATCGGGTTATGGCGCCGTCCTGCCGATTCCTGGGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCTCGGCTATAGGAGCAGCGGAGGGGACAGAGCACGGAATTCCTTTTTTCCTATTGCACCGGGGAGGTCAGACCATGTGGAAAGTCAGCTGTTTGGTAACGGGATTCCTCCTCATCCTCACAGTCATCAGCACCCCCGCTGCAGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCCGCTGGGCACCCTGGCACCGTGTCAGTTACTCAGTCCTTTGTCCAGCCGGTACACAGCCCTATTATGACTCTGTGTGAGGGGCATAGGATCTGCAGTACGTACAGAACGACCTACAAGGTTTCCTACCGTCAA
  5   1   2       bld FaB  5g                         IMAGE:8071175.5p                                                                                                                                                                                                                                                                                                                  GGCAGTATTACAGGGACACAGCCAGGAGGAGCTCAGGGTGCTAAGAAGTGGAGTCTGCTCCTTAAGACAATGGTGATGCTACAATCACAGGCTGAGGAGCCTTGGATCCCGGCTAACTGCCTGCAATCAACATGGCAACTCCCAGTCTGGAGGCACAGCCTGCACCCTGTCTTACACCCAGCAGGCACATGAGAGGCATCGGGTTATGGCGCCGTCCTGCCGATTCCTGGGAAAATGAGCAAATGGAAAAGGGAATCCCATTGAAGGCTCGGCTATAGGAGCAGCGGAGGGGACAGAGCACAGAATTCCTTTTTTCCTATTGCACCGGGGAGGCCAGACCATGTGGAAAGTCAGCTGTTTGGTAACGGGATTCCTCCTCATCCTCACAGTCACCAGCACCCCCGCTGCAGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCCGCTGGGCACCCTGGCACCGTGTCAGTTACCCAGTCCTTTCTCCAGCCGGTACACAGCCCTATTATGACTCTGTGTGAGGGGCATAGGATCTGCAGTACATACAGAACGACCTACAAGGTTTCCTACCGTCAAGTCTCCAGGAGAACATCCTTCCCCCTTTACTCTTGCTGCCCCGGCTGGAGGAGAATCGAGGCGCCCACTCACAGTTGCGGCCAAGTGCTGTGCCGACTGCCATGTCAGAATGGAGGGACGTGCGTCGGTTCTAAATAGTGTGAATGTCCAGCTGGATGGAGAGGGGATCATTGCC
  5   1   2       bld Lu1  5g                         IMAGE:4056753.5p                                                                                                                                                                                                                                                                                                                          TACAGGGACACAGCCAGGAGGAGCTCAGGGTGCTAAGAAGTGGAGTCTGCTCCTTAAGACAATGGTGATGCTACAATCACAGGCTGAGGAGCCTTGGATCCCGGCTAACTGCCTGCAATCAACATGGCAACTCCCAGTCTGGAGGCAGAGCCTGAAACCTGTCTTACACCCAGCAGGCACATGAGAGGCATCGGGTTATGGCGCCGTCCTGCCGATTCCTGGGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCTCGGCTATAGGAGCAGCGGAGGGGACAGAGCACGGAATTCCTTTTTTCCTATTGCACCGGGGAGGCCAGACCATGTGGAAAGTCAGCTGTTTGGTAACGGGATTCCTCCTCATCCTCACAGTCACCAGCACCCCCGCTGCAGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCCGCTGGGCACCCTGGCACCGTGTCAGTTACTCAGTCCTTTGTCCAGCCGGTACACAGCCCTATTATGACTCTGTGTGAGGNGCATANGATCTGCAGTACGTACAGAACGACCTACAAGGTTTCCTACCGTCAAGTCTCCAGGAGAACATCCTTCCCCCTTTACTCTTGCTGCCCCGGCTAGAGGAGAAATCGAGCGCCCACTCACAGTTGCGGGCCAGTGCTGTGCCGACTGCCATGTCAGAAT
  5   1   2       add Emb4 5g                         IMAGE:5542405.5p                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCCCACGCGTCCGGATTGCACAAGCAAAGTGCAAAGAGGCCATTTCCCAAATGCACCGAGGCTGTCTGTGCCCTTACAGAGGCACACGTGGGATTTAAAGGGATCCACAGCAAGAAAGATTAACCTCTTTGTGTCTGCCTTAACTGGAGCCTTCCCTTTGGAGTATCGGGAATTCCATTGAAGCCTTGGCTATAGGAGCAGCAGAGGGGAAAGAACACGGAGATCATTTATTCATATTGCACAGCAGGAGCACCAGGGGCGGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTCCTCATCCTCGCAGTCACCAGCGCCGCCGCTGACCATTTGTACCGGACAGGGCGCAGGATCTGCTCTGCCGATGGGCACCCTGGCACCGTGTCGGTTACCCAGTCCTTTGTCCAGCCGGTACACAGTCCTATCATGACTCTGTGCGAGGGACATAGGATTTGCAGTACGTACAGAACTACCTACAAGGTTTCCTACCGGCAAGTCTCCAGGAAAACGTCCTTTCCACTTTACTCTTGCTGCCCCGGCTGGAGAAGAATCGGGGCGCAAACTCACAGCTGCGGCCAAGCTCTGTGCCGATTGCAATGTCAGAACGGAGGGACTTGCGTCAGTTCTAATAAGTGTGAATGTCCAGCTGGATGGAGAGGGATTCATTGCCAGATGGATGTGGACGAGTGCAGTGATGGCACCCATCAGTGGTTCCAAGCGTGCATCAACTCTGCTGGAAGCTTCAGCTGCGAAATGCCTGGAAAGCTACCGGGTTGATGGCACAATGGAAAAAACCTGGTCCCAAAAGTGGCAGGCAcccccacggtgcccccctgaatcccccccAACCTTCGGTAACAAGAAAATCCACGAAACTTG
  5   1   2       add Emb4 5g                         IMAGE:5542429.5p                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCCCACGCGTCCGGATTGCACAAGCAAAGTGCAAAGAGGCCATTTCCCAAATGCACCGAGGCTGTCTGTGCCCTTACAGAGGCACACGTGGGATTTAAAGGGATCCACAGCAAGAAAGATTAACCTCTTTGTGTCTGCCTTAACTGGAGCCTTCCCTTTGGAGTATCGGGAATTCCATTGAAGCCTTGGCTATAGGAGCAGCAGAGGGGAAAGAACACGGAGATCATTTATTCATATTGCACAGCAGGAGCACCAAGGGCGGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTCCTCATCCTCGCAGACACCAGCGCCGCCGCTGACCATTTGTACCGGACAGGGCGCAGGATCTGCTCTGCCGATGGGCACCCTGGCACCGTGTCGGTTACCCAGTCCTTTGTCCAGCCGGTACACAGTCCTATCATGACTCTGTGCGAGGGACATAGGATTTGCAGTACGTACAGAACTACCTACAAGGTTTCCTACCGGCAAGTCTCCAGGAAAACGTCCTTTCCACTTTACTCTTGCTGCCCCGGCTGGAGAAGAATCGGGGCGCAAACTCACAGCTGCGGCCAAGCTCTGTGCCGATTGCAATGTCAGAACGGAGGGACTTGCGTCAGGTCTAATAAGTGTGAATGTCCAGCTGGATGGAGAGGGATTCATTGCCAGATGTATGTGGACGAGTGCAGTGATGGCACCCATCAGTGTTTCCCTAGCGTGCATCAACTCTGGCTGTAAGCTTCCGGCTGCGAATGCCTTTGAAAGCTTCCCGGTTTGATGGCCGGAATGGAAAAAGACCGTGTCCCAAAAAGTGGCCAGCAACCCAACCGGTGGCCCCCCGTGGCATTCACCCAACCCTCCAGTTACCAAGAAATTCTCGGGAAATTT
  5   1   2       bld Sp1  5g                IMAGE:4963143-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCTAACTGCCTGCAATCAACATGGCAACTCCCAGTCTGGAGGCACAGCCTGCACCCTGTCTTACACCCAGCAGGCACATGAGAGGCATCGGGTTATGGCGCCGTCCTGCCGATTCCTGGGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCTCGGCTATAGGAGCAGCGGAGGGGACAGAGCACGGAATTCCTTTTTTCCTATTGCACCGGGGAGGTCAGACCATGTGGAAAGTCAGCTGTTTGGTAACGGGATTCCTCCTCATCCTCACAGTCATCAGCACCCCCGCTGCAGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCCGCTGGGCACCCTGGCACCGTGTCAGTTACTCAGTCCTTTGTCCAGCCGGTACACAGCCCTATTATGACTCTGTGTGAGGGGCATAGGATCTGCAGTACGTACAGAACGACCTACAAGGTTTCCTACCGTCAAGTCTCCAGGAGAACATCCTTCCCCCTTTACTCTTGCTGCCCCGGCTGGAGGAGAATCGAGGCGCCCACTCACAGTTGCGGCCAAGTGCTGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)