Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012786555 Xl3.1-xl249f01.5 - 5 ESTs
                                                                       .....-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl249f01.5                                              CTCCTGCACTGCAGCGTCTGCTCCACCAACTGCACTGGGATCAGCAGCAGCAGCAGCGCCAAGTCCTGGGGCTAATCTTGCGCCTCCATCACTGTTTCATTCTGTCTGGGGATACAACAAGCTGACACAATTTCACTGTGGACATTACACCCTCTAACAGCTATGGGAGATATGGGAGACCCACCAAAAAAAAAGCGCCTGATTTCTCTGTGTGTTGGATGCGGGAATCAGATCCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCAAAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGGGGACGAGTTCGCGTTGAGGGAGGACGGACTCTTCTGTCGGGCAGACCACGACGTGGTGGAAAGGGCCAGCTTGGGGGGCAGCGACCCTCTCAGTCCCCTTCACCCAGGAAGACCCCTACAGATGGCAGCAGAACCCATTTGTGCCCGGCAGCCCGCGCTCCGACCCCACGTGCACAAGCAGCCAGAGAAGACCACCAGGGTCAGGACGGTTCTTAATGAGAAGCAACTTCACACCTTGAGGACCTGCTACGCTGCCAACCCCAGGCCTGATGCTCTGATGAAGGAACAGCTCGTGGAAATGACTGGACTCAGTCCCAGGGTCATCAGGGTCTGGTTTCAGAACAAGAGGTGCAAGGACAAAAAGAGAAGCATCCTGATAAAGCAGCTACAGCAACAGCAACCTAACGACAAAACCAATATACAAGGGATGACAGGGACCCCTATGGTG
                                                  Xl3.1-CHK-1012705841                                                    CACTGCAGCGTCTGCTCCACCAACTGCACTGGGATCAGCAGCAGCAGCAGCGCCAAGTCCTGGGGCTAATCTTGCGCCTCCATCACTGTTTCATTCTGTCTGGGGATACAACAAGCTGACACAATTTCACTGTGGACATTACACCCTCTAACAGCTATGGGAGATATGGGAGACCCACCAAAAAAAAAGCGCCTGATTTCTCTGTGTGTTGGATGCGGGAATCAGATCCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCAAAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGGGGACGAGTTCGCGTTGAGGGAGGACGGACTCTTCTGTCGGGCAGACCACGACGTGGTGGAAAGGGCCAGCTTGGGGGGCAGCGACCCTCTCAGTCCCCTTCACCCAGGAAGACCCCTACAGATGGCAGCAGAACCCATTTGTGCCCGGCAGCCCGCGCTCCGACCCCACGTGCACAAGCAGCCAGAGAAGACCACCAGGGTCAGGACGGTTCTTAATGAGAAGCAACTTCACACCTTGAGGACCTGCTACGCTGCCAACCCCAGGCCTGATGCTCTGATGAAGGAACAGCTCGTGGAAATGACTGGACTCAGTCCCAGGGTCATCAGGGTCTGGTTTCAGAACAAGAGGTGCAAGGACAAAAAGAGAAGCATCCTGATAAAGCAGCTACAGCAACAGCAACCTAACGACAAAACCAATATACAAGGGATGACAGGGACCCCTATGGTGGCCTCC
                                                      consensus depths                                                   2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     1     3     1     3     1     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2
                                               BLH ATG     162     818                                              
                                               BLH MIN     132     189                                              
                                               BLH MPR      42     189                                              
                                               BLH OVR     162     993                                              
                                               ORF LNG     162      43                                              
                                                                                                                                                                          PROTEIN --- Ce ---- 1e-049     NP_491668.1 LIM domain protein (lim-7) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN --- Dm ---- 6e-093     NP_476775.1 tailup CG10619-PA [Drosophila melanogaster] ---------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PROTEIN --- Ag ---- 4e-096     XP_319393.4 AGAP010209-PA [Anopheles gambiae str. PEST] ------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 8e-100     NP_001027767.1 LIM homeodomain protein [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED - Sp ---- 2e-111     XP_001187996.1 PREDICTED: similar to insulin gene enhancer binding protein Isl-1 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 2e-121     XP_001254463.2 PREDICTED: similar to Insulin gene enhancer protein ISL-2 (Islet-2) [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PREDICTED = Cf ==== 5e-154     XP_853721.1 PREDICTED: similar to Insulin gene enhancer protein ISL-1 (Islet-1) isoform 1 [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 1e-155     NP_990745.1 domesticus (clone 1.7 kB) islet-1 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 1e-155     NP_571037.1 islet1 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 4e-156     NP_067434.3 ISL1 transcription factor, LIM/homeodomain [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 4e-156     NP_002193.2 islet-1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Bt ==== 3e-156     NP_001092600.1 islet-1 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 3e-157     AAT72002.1 isl1 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 2e-160     NP_001104188.1 islet-1 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl249f01.5                                                                                                                      TAA---------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------ATG
                                                                   ORF                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Em10 5g                         IMAGE:8320777.5p GTTGGAGCAGAGAAGTTTGAGCAAGAGATAAGGAAGAGAAGGGGACTCCTGCACTGCAGCGTCTGCTCCACCAACTGCACTGGGATcagcagcagcagcagcGCCAAGTCCTGGGGCTAATTTTGCGCCTCCATCACTGTTTCATTCTGTCTGGGGATACAACAAGCTGACACAATTTCACTGTGGACATTACACCCTCTAACAGCTATGGGAGATATGGGAGACCCACCaaaaaaaaaGCGCCTGATTTCTCTGTGTGTTGGATGCGGGAATCAGATCCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCAAAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGGGGACGAGTTCGCGTTGAGGGAGGACGGACTCTTCTGTCGGGCAGACCACGACGTGGTGGAAAGGGCCAGCTTGGGGGGCAGCGACCCTCTCAGTCCCTTCACCCAGGAAGACCCTACAGATGCAGCAGACCCATTGTGCCGGCAGCCGCGCTCGACCCACGTGCACAGCAGCAGAGAGACACAGGGTCAGACGGGTCTATGAGAGCACTCCACTTGAGACTGCACCTG
  5   1   2      seed DMZ  5g                              xl249f01.5p                                              CTCCTGCACTGCAGCGTCTGCTCCACCAACTGCACTGGGATcagcagcagcagcagcGCCAAGTCCTGGGGCTAATCTTGCGCCTCCATCACTGTTTCATTCTGTCTGGGGATACAACAAGCTGACACAATTTCACTGTGGACATTACACCCTCTAACAGCTATGGGAGATATGGGAGACCCACCaaaaaaaaaGCGCCTGATTTCTCTGTGTGTTGGATGCGGGAATCAGATCCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCAAAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGGGGACGAGTTCGCGTTGAGGGAGGACGGACTCTTCTGTCGGGCAGACCACGACGTGGTGGAAAGGGCCAGCTTGGGGGGCAGCGACCCTCTCAGTCCCCTTCACCCAGGAAGACCCCTACAGATGGCAGCAGAACCCATTTGTGCCCGGCAGCCCGCGCTCCGACCCCACGTGCACAAGCAGCCAGA
  5   1   2       bld Tbd4 5g                         IMAGE:4058863.5p                                                        CCGGGGTCTGCTCCACCAACTGCACTGGGATcagcagcagcagcagcGCCAAGTCCTGGGGCTAATCTTGCGCCTCCATCACTGTTTCATTCTGTCTGGGGATACAACAAGCTGACACAATTTCACTGTGGACATTACACCCTCTAACAGCTATGGGAGATATGGGAGACCCACCaaaaaaaaaGCGCCTGATTTCTCTGTGTGTTGGATGCGGGAATCAGATCCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCANAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGTGGACGAGTTCGCGTTGAGGGAGGACGGACTCTTCTGTCGGGCAGACCACGACGTGGTGGATAGGGCCAGCTTGGGGGGGAGCGACTCTCTCAGTCTCCTTCACCCAGGAGGACCCCTACAGATGGCAGAACCCATATGTGCCCTGCAGATCGCGCTTCGACCCCACGTGCAACAACAGCCAGAGTAGACCACCCATGTTATGACAGTTCTTATTGAGAAC
  5   1   2       bld Ga15      out                      XL516b15ex.5p                                                                                                                                                                                                                                                                                       CCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCAAAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGGGGACGAGTTCGCGTTGAGGGAGGACGGACTCTTCTGTCGGGCAGACCACGACGTGGTGGAAAGGGCCAGCTTGGGGGGCAGCGACCCTCTCAGTCCCCTTCACCCAGGAAGACCCCTACAGATGGCAGCAGAACCCATTTGTGCCCGGCAGCCCGCGCTCCGACCCCACGTGCACAAGCAGCCAGAGAAGACCACCAGGGTCAGGACGGTTCTTAATGAGAAGCAACTTCACACCTTGAGGACCTGCTACGCTGCCAACCCCAGGCCTGATGCTCTGATGAAGGAACAGCTCGTGGAAATGACTGGACTCAGTCCCAGGGTCATCAGGGTCTGGTTTCAGAACAAGAGGTGCAAGGACAAAAAGAGAAGCATCCTGATAAAGCAGCTACAGCAACAGCAACCTAACGACAAAACCAATATACAAGGGATGACAGGGACCCCTATGGTGGCCTCCA
  5   1   2      skin Ga15                               XL482h22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAAAACCAATATACAAGGGATGACAGGGACCCCTATGGTGGCCTCCAGTCCCGAAAGACACGACGGTGGGTTACAGGCGAACCCGGTGGAAGTGCAGACTTATCAGCCCCCCTGGAAAGTCCTCAGTGACTTTGCCCTACAGAGTGACATTGATCAGCCGGCCTTCCAGCAACTGGTTAATTTTTCAGAAGGAGGACCTGGCTCTAACTCTACAGGGAGTGAGGTGGCCTCCATGTCCTCCCAGCTCCCAGATACCCCAAACAGCATGGTAGCCAGCCCTATAGAGGCATGATGGGCATGGACTGGTTCCCTCTGTTGAGGGCAAAGCTTGGACTGAAAGGAAGTGTTTTAGGACCCAGCAGACAGAGAATCCAGCCAACTCCATAGGATGCGGGGCCGCCTACAGAACATGGGATGGCAGCCACACTGTGAAGACAATCATGGGATCTTACTAGGAGTGAAGGACAAGGACATGGTGGTTGGAGTATCACGGCAGACAAGATTGAGTGCTGTAGAGGATTTCTATCTATGGATCTCCAAAAATAGCATTTAACCTTccccccataccccccATTGGAACATCCCAGAACAGACCAAGATGGACCCAGATAGGAGGGATCACCCTAATCCCAATGGTGCTTCTTTTATCTCTCCTGACATCACTTAATCACTGCCCTGCCAAACAGGAGCTGCGATCGATCTGCAGGCAGCACCCCAGACTCAAGTTAAAGGGACAGTGCTTGGGATCCCTGCAGGGTGAGATGTTGGAGTTGCCATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)