Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk145g21ex.3                         5 END     1          25       20                PREDICTED: similar to squamous cell carcinoma antigen recognized by T cells 3 isoform 1 [Canis familiaris]

 This cluster: approximate FL confidence score = 11%

 1012786618 Xl3.1-IMAGE:5078867.5 - 4 ESTs
                                                                       .....-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5078867.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATCCGCTTTCCGCTTATTTGAATTTACCTCTCAATAATAGCTCAGAGCTCATCCACAAAAGAGCGGTCACATGGTAGGAACACGTGGCCGTGACGTCAGCAAGGTCCTTTCCGAGGATAGGAACTAGACGCTACGACGCAACAATCATGGCGGATGCTAAACGTGGGGACGAGGGAATAGAAGCCCAGGGTGTAGGGGATGAAGAGGAGGAGATGGAGTCTGAGGGAGAAGGATCCGCGGATGATTCCTCTGAGGGAACAGGCCAATCTTCTTGTGAGGAGGATGATGAAAAGGAAAACGAAGCGGAGATTCAGAGGCTGGAAGAGCAATTATCTATTAATGCCTTTGATTACAACTGTCATGTTGATCTCATCAAACTGCTGCGACAAGAAGGGGAGCTGGAGAGGCTTAGACGTGCACGGCAGAAGATGAGCGAGCTTTTTCCATTAACTAAAGAGATTTGGCTGGACTGGCTTATGGATGAAATGAAAGTTGCAGATCAAGGATCCTGCCGTGAGAAAGTTTATGAACTCTTTGAACGAGCAGTGAAAGACTATATATGTCCAGAAATTTGGCTGGAATATGCACAGTATTCGATCGGTGGTATGGGAGAGGAGGGTGGCATTGCAAAAGTTCGCTCTATCTTTGAGAGAGCACTAACTGCTGTAGGACTTCATATGACTAAAGGATCCACACTTTGGGATGCATACAGGGAATTTGAAAATGCGATCTTAGGAACCATACAGCCAGTGCCGGGCAGCATCCCTTCACCAGAGCAGCAGCAGATGCTACAGGCACAACTTCAGCGGATCCACACACTATTCAGACGTCAGCTTGGTGTACCTCTCTTAGACATGACTTCAACATATGCTGAATATGAAGAGTGGTCAGAGGAACCAATATCAGAAGCTCTGATGCAAAGTTATAAAAAAGCCTTGCAGCAGATGAAAAAGTGCAAACACTATGAAGAAGGCTCTGCTATGCAGAAACTCCT
                                                  Xl3.1-CHK-1012707933                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTTTCCGCTTATTTGAATTTACCTCTCAATAATAGCTCAGAGCTCATCCACAAAAGAGCGGTCACATGGTAGGAACACGTGGCCGTGACGTCAGCAAGGTCCTTTCCGAGGATAGGAACTAGACGCTACGACGCAACAATCATGGCGGATGCTAAACGTGGGGACGAGGGAATAGAAGCCCAGGGTGTAGGGGATGAAGAGGAGGAGATGGAGTCTGAGGGAGAAGGATCCGCGGATGATTCCTCTGAGGGAACAGGCCAATCTTCTTGTGAGGAGGATGATGAAAAGGAAAACGAAGCGGAGATTCAGAGGCTGGAAGAGCAATTATCTATTAATGCCTTTGATTACAACTGTCATGTTGATCTCATCAAACTGCTGCGACAAGAAGGGGAGCTGGAGAGGCTTAGACGTGCACGGCAGAAGATGAGCGAGCTTTTTCCATTAACTAAAGAGATTTGGCTGGACTGGCTTATGGATGAAATGAAAGTTGCAGATCAAGGATCCTGCCGTGAGAAAGTTTATGAACTCTTTGAACGAGCAGTGAAAGACTATATATGTCCAGAAATTTGGCTGGAATATGCACAGTATTCGATCGGTGGTATGGGAGAGGAGGGTGGCATTGCAAAAGTTCGCTCTATCTTTGAGAGAGCACTAACTGCTGTAGGACTTCATATGACTAAAGGATCCACACTTTGGGATGCATACAGGGAATTTGAAAATGCGATCTTAGGAACCATACAGCCAGTGCCGGGCAGCATCCCTTCACCAGAGCAGCAGCAGATGCTACAGGCACAACTTCAGCGGATCCACACACTATTCAGACGTCAGCTTGGTGTACCTCTCTTAGACATGACTTCAACATATGCTGAATATGAAGAGTGGTCAGAGGAACCAATATCAGAAGCTCTGATGCAAAGTTATAAAAAAGCCTTGCAGCAGATGAAAAAGTGCAAACACTATGAAxxAGGCTC------------ACTCCTAAGCTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3     1     3     2     3     2     2     2     2     1     2     2     2     2     2     1     2     1     1
                                               BLH ATG     148      15                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     118     107                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                       PROTEIN --- Dm ---- 2e-008     NP_001097960.1 CG1646 CG1646-PG, isoform G [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ==== 3e-013     NP_502136.1 RNA recognition motif containing protein (95.5 kD) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = ?? ==== 2e-025     XP_629950.1 hypothetical protein DDBDRAFT_0191602 [Dictyostelium discoideum AX4] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Os ---- 1e-041     NP_001060838.1 Os08g0113200 [Oryza sativa (japonica cultivar-group)] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- At ---- 2e-043     NP_194158.3 RNA recognition motif (RRM)-containing protein [Arabidopsis thaliana] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 3e-051     XP_781643.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 8e-086     NP_055521.1 squamous cell carcinoma antigen recognized by T cells 3; tat-interacting proteinof 110 kDa [Homo sapiens] ----------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bt ---- 2e-086     NP_001095330.1 squamous cell carcinoma antigen recognized by T cells 3 [Bos taurus] --------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 9e-087     NP_058622.1 squamous cell carcinoma antigen recognized by T-cells 3 [Mus musculus] ---------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Cf ---- 2e-090     XP_543445.2 PREDICTED: similar to squamous cell carcinoma antigen recognized by T cells 3 isoform 1 [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 1e-092     CAJ82400.1 Novel protein similar to Sart3 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ==== 5e-104     XP_415181.2 PREDICTED: similar to SART3 protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 1e-105     NP_001025289.1 hypothetical protein LOC558581 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 2e-158     AAI57502.1 Unknown (protein for IMAGE:6639358) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5078867.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAG---------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------ATG---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Oo1                             IMAGE:6639358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATCCGCTTTCCGCTTATTTGAATTTACCTCTCAATAATAGCTCAGAGCTCATCCACAAAAGAGCGGTCACATGGTAGGAACACGTGGCCGTGACGTCAGCAAGGTCCTTTCCGAGGATAGGAACTAGACGCTACGACGCAACAATCATGGCGGATGCTAAACGTGGGGACGAGGGAATAGAAGCCCAGGGTGTAGGGGATGAAGAGGAGGAGATGGAGTCTGAGGGAGAAGGATCCGCGGATGATTCCTCTGAGGGAACAGGCCAATCTTCTTGTGAGGAGGATGATGAAAAGGAAAACGAAGCGGAGATTCAGAGGCTGGAAGAGCAATTATCTATTAATGCCTTTGATTACAACTGTCATGTTGATCTCATCAAACTGCTGCGACAAGAAGGGGAGCTGGAGAGGCTTAGACGTGCACGGCAGAAGATGAGCGAGCTTTTTCCATTAACTAAAGAGATTTGGCTGGACTGGCTTATGGATGAAATGAAAGTTGCAGATCAAGGATCCTGCCGTGAGAAAGTTTATGAACTCTTTGAACGAGCAGTGAAAGACTATATATGTCCAGAAATTTGGCTGGAATATGCACAGTATTCGATCGGTGGTATGGGAGAGGAGGGTGGCATTGCAAAAGTTCGCTCTATCTTTGAGAGAGCACTAACTGCTGTAGGACTTCATATGACTAAAGGATCCACACTTTGGGATGCATACAGGGAATTTGAAAATGCGATCTTANGAACCATACAGCCAGTGCCGGGCAGCATCCCTTCACCAGAGCAGCAGCAGATGCTACAGGCACAACTTCAGCGGATCCACACACTATTCAGACGTCAGCTTTGGTGTACCTCTCTTAGACATGACTTTCAACATATGCTGAAATATGAAAGAGTGGGTCCAGAGGGAACCAATTATCCAGAAGGCT
  5   1   2      seed Oo1                             IMAGE:5078867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCAGCAAGGTCCTTTCCGAGGATAGGAACTAGACGCTACGACGCAACAATCATGGCGGATGCTAAACGTGGGGACGAGGGAATAGAAGCCCAGGGTGTAGGGGATGAAGAGGAGGAGATGGAGTCTGAGGGAGAAGGATCCGCGGATGATTCCTCTGAGGGAACAGGCCAATCTTCTTGTGAGGAGGATGATGAAAAGGAAAACGAAGCGGAGATTCAGAGGCTGGAAGAGCAATTATCTATTAATGCCTTTGATTACAACTGTCATGTTGATCTCATCAAACTGCTGCGACAAGAAGGGGAGCTGGAGAGGCTTAGACGTGCACGGCAGAAGATGAGCGAGCTTTTTCCATTAACTAAAGAGATTTGGCTGGACTGGCTTATGGATGAAATGAAAGTTGCAGATCAAGGATCCTGCCGTGAGAAAGTTTATGAACTCTTTGAACGAGCAGTGAAAGACTATATATGTCCAGAAATTTGGCTGGAATATGCACAGTATTCGATCGGTGGTATGGGAGAGGAGGGTGGCATTGCAAAAGTTCGCTCTATCTTTGAGAGAGCACTAACTGCTGTAGGACTTCATATGACTAAAGGATCCACACTTTGGGATGCATACAGGGAATTTGAAAATGCGATCTTAGGAACCATACAGCCAGTGCCGGGCAGCATCCCTTCACCAGAGCAGCAGCAGATGCTACAGGCACAACTTCAGCGGATCCACACACTATTCAGACGTCAGCTTGGTGTACCTCTCTTAGACATGACTTCAACATATGCTGAATATGAAGAGTGGTCAGAGGAACCAATATCAGAAGCTCTGATGCAAAGTTATAAAAAAGCCTTGCAGCAGATGAAAAAGTGCAAACACTATGAAAGAGGCTCTGCTAT
  5   1   2       bld Ga18      out                     xlk162c04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGTCCTTTCCGAGGATAGGAACTAGACGCTACGACGCAACAATCATGGCGGNNGNNAACGTGGGGNCGAGGGAATAGAAGCCCAGGGTGTAGGGGATGAAGAGGAGGAGATGGAGTCTGAGGGAGAAGGATCCGCGGATGATTCCTCTGAGGGAACAGGCCAATCTTCTTGTGAGGAGGATGATGAAAAGGAAAACGAAGCGGAGATTCAGAGGCTGGAAGAGCAATTATCTATTAATGCCTTTGATTACAACTGTCATGTTGATCTCATCAAACTGCTGCGACAAGAAGGGGAGCTGGAGAGGCTTAGACGTGCACGGCAGAAGATGAGCGAGCTTTTTCCATTAACTAAAGAGATTTGGCTGGACTGGCTTATGGATGAAATGAAAGTTGCAGATCAAGGATCCTGCCGTGAGAAAGTTTATGAACTCTTTGAACGAGCAGTGAAAGACTATATATGTCCAGAAATTTGGCTGGAATATGCACAGTATTCGATCGGTGGTATGGGAGAGGAGGGTGGNATTNCAAAAGTTCGCTCTATCTTTGAGAGAGCACTAACTGCTGTAGGACTTCATATGACTNAAGGANCCACACTTTGGGATGCATACAGGGAANTTGAAAATGCGATCTTAGGAANCATACAGCCAGTGCCGGGCAGCATCCCTTCACCAGAGCAGCAGNAGATNNTACAGGCACAACTTCAGCGGATCCACACACTATTCAGACGTCAGCTTG
  5   1   2       bld Ga18      out                     xlk145g21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGGAGAAGGANCCGCGGATGATTCCTCTGAGGGAACAGGCCAATCTTCTTGTGAGGAGGATGATGAAAAGGAAAACGAAGCGGAGATTCAGAGGCTGGAAGAGCAATTATCTATTAATGCCTTTGATTACAACTGTCATGTTGATCTCATCAAACTGCTGCGACAAGAAGGGGAGCTGGAGAGGCTTAGACGTGCACGGCAGAAGATGAGCGAGCTTTTTCCATTAACTAAAGAGATTTGGCTGGACTGGCTTATGGATGAAATGAAAGTTGCAGATCAAGGATCCTGCCGTGAGAAAGTTTATGAACTCTTTGAACGAGCAGTGAAAGACTATATATGTCCAGAAATTTGGCTGGAATATGCACAGTATTCGATCGGTGGTATGGGAGAGGAGGGTGGCATTNCAAAAGTTCGCTCTATCTTTGAGAGAGCACTAACTGCTGTAGGACTTCATATGACTAAAGGATCCACACTTTGGGATGCATACAGGGAATTTGAAAATGCGATCTTAGGAACCATACAGCCAGTGNCGGGCAGCATCCCTTCACCAGAGCAGCAGNAGATGCTACAGGCACAACTTCAGCGGATCCACACACTATTCAGACGTCAGCTTGGTGTANCTCTCTTAGACATGACTNCNACATATGCTGAATATGAAGAGTGGNCAGAGGAANCAATATCAGAGGNTCTGATGCAAAGTTATAAAAAAGCCTTNNAGCAGATGAAAAAGTGCAAACACTATGAAGAGGCTCNNNAGCTGCAGAAACTCCTAAGCTTGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)