Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7019502.5                       2 END     1          20       50                hypothetical protein LOC100125031 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6945760.5                      12 PI      95          1      708                pituitary adenylate cyclase-activating peptide [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:7019502.5                       2 PI      96          1      310                hypothetical protein LOC100125031 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 84%

 1012786731 Xl3.1-IMAGE:6947969.3 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6947969.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGATGCAGCTGGCCACTTTCTAACAGACACGTGCACAAACTTACCGGCCACTTGGCTCAATTCGAAACCAGGCAGCTCTCTGTATAGGACTTGCTCTTTTATATGAAAGACAATGTTTAGGAAAGTGCTGCTCGTCTGGCTTCTGCTCTATGGCATCACGCGCTGCAGCGTCCACTCTTCACCTGCTGCGCTCAAGTATCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCCATGGGTATGGGGAACCCCTCCTCGGTCCTAGACGATATGTTCTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTACATACTCTGATGGCCCAACGCTTAGGAACAATCAGTAGCAGCTTAGAAGACGAGTCGGAACCCTTATCCAAACGGCACTCAGATGGAATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTTAAGAAATACTTGGCAGCGGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCCTATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCCATCCACCCAGTCATCCCCCAACTGACTGAACAATCATCGCT
                                                  Xl3.1-CHK-1012704344                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCTGGCCACTTTCTAACAGACACGTGCACAAACTTACCGGCCACTTGGCTCAATTCGAAACCAGGCAGCTCTCTGTATAGGACTTGCTCTTTTATATGAAAGACAATGTTTAGGAAAGTGCTGCTCGTCTGGCTTCTGCTCTATGGCATCACGCGCTGCAGCGTCCACTCTTCACCTGCTGCGCTCAAGTATCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCCATGGGTATGGGGAACCCCTCCTCGGTCCTAGACGATATGTTCTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTACATACTCTGATGGCCCAACGCTTAGGAACAATCAGTAGCAGCTTAGAAGACGAGTCGGAACCCTTATCCAAACGGCACTCAGATGGAATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTTAAGAAATACTTGGCAGCGGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCCTATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCCATCCACCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCTTGTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     3     5     3     5     2     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3
                                               BLH ATG     113      74                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     113      48                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     113     150                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     113       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ---- 2e-036     NP_001001291.1 growth hormone-releasing hormone/pituitary adenylate cyclase-activating polypeptide precursor [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 4e-045     NP_001108.2 adenylate cyclase activating polypeptide precursor [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bt ---- 1e-046     NP_001040020.1 adenylate cyclase activating polypeptide [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 1e-049     NP_033755.1 adenylate cyclase activating polypeptide 1 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 5e-053     NP_999880.1 adenylate cyclase-activating peptide 1 like [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 3e-053     XP_849191.1 PREDICTED: similar to Pituitary adenylate cyclase activating polypeptide precursor (PACAP) [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xt ==== 2e-068     NP_001096425.1 hypothetical protein LOC100125031 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 2e-092     NP_001081947.1 pituitary adenylate cyclase-activating peptide [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6947969.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAG---TGA------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  3   1   2      seed Eye1 5g3  out                   IMAGE:6947969.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCCTCTGCCCCAGTGGGAATCCCCTTGGCTTTTTTTTTTTCTTCTGCGGGATTTGTTGGCTTACTTCAAACTTTTAATCACCACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGGCCACTTTCTAACAGACACGTGCACAAACTTACCGGCCACTTGGCTCAATTCGAAACCAGGCAGCTCTCTGTATAGGACTTGCTCTTTTATATGAAAGACAATGTTTAGGAAAGTGCTGCTCGTCTGGCTTCTGCTCTATGGCATCACGCGCTGCAGCGTCCACTCTTCACCTGCTGCGCTCAAGTATCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCCATGGGTATGGGGAACCCCTCCTCGGTCCTAGACGATATGTTCTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTACATACTCTGATGGCCCAACGCTTAGGAACAATCAGTAGCAGCTTAGAAGACGAGTCGGAACCCTTATCCAAACGGCACTCAGATGGAATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTTAAGAAATACTTGGCAGCGGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCCTATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCCATCCACCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCTTGTGTTACCTACACACATGTTGAA
  5   1   2       bld Gas7      in                    IMAGE:4083571.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGAGACAGAACGATGCAGCTGGCCACTTTCTAACAGACACGTGCACAAACTTACCGGCCACTTGGCTCAATTCGAAACCAGGCAGCTCTCTGTATAGGACTTGCTCTTTTATATGAAAGACAATGTTTAGGAAAGTGCTGCTCGTCTGGCTTCTGCTCTATGGCATCACGCGCTGCAGCGTCCACTCTTCACCTGCTGCGCTCAAGTATCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGGTTGAGAACGAACCCATGGGTATGGGGAACCCCTCCTCGGTCCTAGACGATATGTTCTCATTTTATTACCCGCCGGAAAAGAGAACAATCAGTAGCAGCTTAGAAGACGAGTCGGAACCCTTATCCAAACGGCACTCAGATGGAATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTTAAGAAA
  5   1   1       add Ga18 5g3  in                      xlk102e08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTAGCCTAGTATTTGGGGTATTGGTCAATGCGTGTTTAAGTGATATCCTTCATTTCTTGTCTGCAGAAAGACAATGTTTAGGAAAGTGCTGCTCGTCTGGCTTCTGCTCTATGGCATCACGCGCTGNNNNNCCACTCTTCACCTGCTGCGNTCAAGTATCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCCATGGTATGGGGAANCCCTCCTCGGTCCTAGACGATATGTTCTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGNNATTTGTCTGCAAGAAAATACCTACATACTCTGATGGCCCAACGCTTAGGAACAATCAGTAGCAGCTTAGAAGACGAGTCGGAACCCTTATCCAAACGGCACTCAGATGGAATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTTAAGAAATACTTGGCAGCGGTNNNGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCNATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTNCAGCCCCATCCACCCAGTCATCCCCCAACTGANTGANCNATCATCGCTCTNGTGTTACCTACAAACATGTATTTATGTATGAAGNAAGCCATNNAATGAATATTTNNTaaaaaaaaaa
  3   1   1       add Ga18 5g3  in                      xlk102e08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTAGCCTAGTATTTGGGGTATTGGTCAATGCGTGTTTAAGTGATATCCTTCATTTCTTGTCTGCAGAAAGACAATGTTTAGGAAAGTGCTGCTCGTCTGNCTTCTGCTCTATGNCATCNCNNNNGCAGCGTCCACTCTTCACNNCNGNGCTCAAGTATCCAGNACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGNNCCATGGGTATGGGGAACCCCTCCTCGGTCCTAGACGATATGTTCTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTACATACTCTGATGGCCCAACGCTTAGGAACAATCAGTAGCAGCTTAGAAGACGAGTCGGAACCCTTATCCAAACGGCACTCAGATGGAATCTTCNCCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTTAAGAAATACTTGGCAGCGGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCCTATTTGTAGCGATGAGTCTCCAGCAGCCNCCTCGTGTGTACAGCCCCATCCACCCAGTCNTCCCCCAACTGACTGAACAATCATCGCTCTTGTGTTNCCTACAAACATGTATTTATGTATGAA
  3   1   2      skin Gas7      in                    IMAGE:4083571.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCTGCTCTATGGCATAACGCGCTGCAGGGTCCACTCTTCACCTGCTGCGCTCAAGTATCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCCATGGGTATGGGGAACCCCTCCTCGGTCCTAGACGATATGTTCTCATTTTATTACCCGCCGGAAAAGAGAACAATCAGTAGCAGCTTAGAAGACGAGTCGGAACCCTTATCCAAACGGCACTCAAATGGAATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTTAAGAAATACTTGGCAGCGGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCCTATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCCATCCACCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCTTGTGTTACCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTAATAATAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)