Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk135i12ex.3                        31 END     3          33        9                (no blast hit)
     2   1.0    0Xl3.1-xlk143e12ex.3                         7 END     1          11       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:8528261.5                      18 PI      100      1208     1332                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:6325381.5                       5 PI      94        636     1330                fibroblast growth factor receptor [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012786956 Xl3.1-IMAGE:5154831.5 - 9 ESTs
                                                                       .........-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5154831.5                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACTAACCGCACGCGCATAACAGGGGAGGAGATCCAAATTTCCAACGCAGGGCCGGAGGACAATGGGCTGTATGCCTGTGTTACTATCGGGCCTTCTGGAACATATACAGTATTATTCTCCATTAATGTATCAGATGCGCAGCCTTCGGCCGAGGACGACGATGATGATGATGACAATTCATCCTCTGAGGAGAAAGCTTCGGAGAACTCCAAACCGAACCGTCCCTTTTGGTCACACCCAGAAAAGATGGAGAAGAAGCTTCATGCCGTGCCGGCAGCAAAAACGGTGAAATTTAGGTGTCCGGCAAATGGCACTCCATCGCCCGCACTTCGCTGGTTGAAGAATGGCAAGGAGTTCCGACCCGATCAGAGCGCATTGGTGGATATAAGGTCCGGTCTCAAACATGGAGTCTTATTATGGATTCCGTTGTCCCATCTGATAAAGGAAATTACACCTGTATTGTGGAGAACAAGTATGGCACCCTCAACCACACGTACCAGTTGGATGTTGTCGAGCGTTCCCCACACCGCCCTATCCTACAAGCCGGTCTCCCAGCAAATACAAGTGTTACTGTGGGAAGCACCGCCGAGTTTTCCTGCAAAGTGTACAGCGACCCCCAGCCTCACATCCAGTGGCTCAGGCACATAGAGATTAACGGCAGTAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTGAAGTTGAGGACGATAAACCCGCACTTCTGGCCTCCCCTTTACAACTGGAGATTATCATCTACTGCACGGGGGCTGCCTTTGTGTCCGCCATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAGCTGGCTGTGCACAAGCTCGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAACTCATCAATGCACTCTGGAGTGATATTGGTTAGGCCTTCGCGCCTTTCTTCCAGTGGGACACCCATGTTGTCTGGAGTCTCGGAATATGAGCTTCCGGAAGATCCACGATGGGAAGTGGCAAGGGACAGGCTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAGGTAGTAATGGCGGAGGCTATAGGCCTGGACAAGGAGAAGCCTAACCGAGTAACAAAAGTCGCCTTGAAGATGCTGAAGTCTGATGCAA
                                                  Xl3.1-CHK-1012696513                                                                                                                                                                                                                                                                                                                                                                                                                                AACCGCACGCGCATAACAGGGGAGGAGATCCAAATTTCCAACGCAGGGCCGGAGGACAATGGGGTGTATGCCTGTGTTACTAACGGGCCTTCTCGAACATATACAGTATTATTCTCCGTTAATGTATCAGATGCxCxGCCTTCGGCCGAGGACGAxGATGAxGATGATGACAATTCATCCTCTGAGGAGAAAGCTxCxGAxAACTCCAAACCGAACCGTCCCTTTTGGTCACACCCAGAAAAGATGGAGAAGAAGCTTCATGCCGTGCCGGCAGCAAAAACGGTGAAATTTAGGTGTCCGGCAAATGGCACTCCATCGCCCGCACTTCGCTGGTTGAAGAATGGCAAGGAGTTCCGACCCxAxxxxAGCGCATTGGTGGATATAAGGTCCGGTCTCAAACATGGAGTCTTATTATGGATTCCGTTGTCCCATCTGATAAAGGAAATTACACCTGTATTGTGGAGAACAAGTATGGCACCCTCAACCACACGTACCAGTTGGATGTTGTCGAGCGTTCCCCACACCGCCCTATCCTACAAGCCGGTCTCCCAGCAAATACAAGTGTTACTGTGGGAAGCACCGCCGAGTTTTCCTGCAAAGTGTACAGCGACCCCCAGCCTCACATCCAGTGGCTCAGGCACATAGAGATTAACGGCAGTAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTGAAGTTGAGGACGATAAACCCGCACTTCTGGCCTCCCCTTTACAACTGGAGATTATCATCTACTGCACGGGGGCTGCCTTTGTGTCCGCCATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAGCTGGCTGTGCACAAGCTCGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAACTCATCAATGCACTCTGGAGTGATATTGGTTAGGCCTTCGCGCCTTTCTTCCAGTGGGACACCCATGTTGTCTGGAGTCTCGGAATATGAGCTTCCGGAAGATCCACGATGGGAAGTGGCAAGGGACAGGCTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAGGTAGTAATGGCGGAGGCTATAGGCCTGGACAAGGAGAAGCCTAACCGAGTAACAAAAGTCGCCTTGAAGATGCTGAAGTCTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                               3     4     3     4     3     4     3     4     3     4     1     2     3     4     1     2     1     2     3     4     1     2     1     2     3     4     1     2     3     4     3     4     1     2     1     2     1     2     1     2     1     2     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     4     4     5     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN     347     276                                                                                                                                                                                                                                                                                                                                                                                                                          
  5   1   0       add Emb1                   IMAGE:6634100-IMAGp.IMAGp CACAGCTGTTTTAAACGAAAAATACttttttttaaaacattttttaattttttttttaattttAGCTTCATTCTCTACGAACATCGGATTCCTGGGAGAAATTTTAATTTTTAAAAGTTATTGGAAGAGGATATTTAAAAAGTAAAATTAAGGCTTGttttttttttttttttttttaaagattttagagatttttttttGAAAATAATTTTTCCCCCTACTAATAAAAGGAATATAAGTGTTGGACGATCCGAGATAAGAAACTAAACATTTGGAAACAGTCGCCCCTAAAACCAAAACGGAAGTGGAGCCGTATTCTGCTCAGCCAGGAGACAGGATAACTTTGCAGTGCAGGCTACGAGAAGATGTTCAGAGCATCAACTGGGTGAAAAATGGAGTTCAGCTTTCGGAGACTAACCGCACGCGCATAACAGGGGAGGAGATCCAAATTTCCAACGCAGGGCCGGAGGACAATGGGGTGTATGCCTGTGTTACTAACGGGCCTTCTCGAACATATACAGTATTATTCTCCGTTAATGTATCAAATGCACTGCCTTCGGCCGAGGACGATGATGAAGATGATGACAATTCATCCTCTGAGGAGAAAGCTGCAGAAAACTCCAAACCGAACCGTCCACTTTGGTCACATCCAGAAAAAATGGAGAAGAAGCTTCATGCAGTGCCAGCAGCAAA
  5   1   0       add Emb1                            IMAGE:6634100.5p  ACAGCTGTTTTAAACGAAAAATACttttttttaaaacattttttaattttttttttaattttAGCTTCATTCTCTACGAACATCGGATTCCTGGGAGAAATTTTAATTTTTAAAAGTTATTGGAAGAGGATATTTAAAAAGTAAAATTAAGGCTTGttttttttttttttttttttaaagattttagagatttttttttGAAAATAATTTTTCCCCCTACTAATAAAGGGAATATAAGTGTTGGACGATCCGAGATAAGAAACTAAACATTTGGAAACAGTCGCCCCTAAAACCAAAACGGAAGTGGAGCCGTATGCTGCTCAGCCAGGAGACAGGATAACTTTGCAGTGCAGGCTACGAGAAGATGTTCAGAGCATCAACTGGGTGAAAAATGGAGTTCAGCTTTCGGAGACTAACCGCACGCGCATAACAGGGGAGGAGATCCAAATTTCCAACGCAGGGCCGGAGGACAATGGGGTGTATGCCTGTGTTACTAACGGGCCTTCTCGAACATATACAGTATTATTCTCCGTTAATGTATCAGATGCACTGCCTTCGGCCGAGGACGATGATGAAGATGATGACAATTCATCCTCTGAGGAAAAAGCTGCAGAAAACTCCAAACCGAAACGGTCCACTTTTGGTCCCTTCCAGAAAAAAATGGGAGAAGAAAGCTTCATGCAGGGGCCAGCCAGCAAAAAACTGGTAAAATTTTAGGGTGTCCCAGCAAAATGGGGAACCTCCCAAAGGCCCAAAAACTTTTCTCTTGGGCTTGAAAAAAATTGGCAGGGGCGGGTTTCCCCAACAAAGAAATCCAGCCGGCATTTggggggggAAAAAATAAAGGGGCCCCGGGGTTTTTCGAAAACAATTGGGGAGAGTCCTTCTAATTTACTGGGGGAAA
  5   1   1       add Oo1                             IMAGE:6861854.5p                                                                                                                                                                       GCAGTGTGCACTAGCCAACTTGGGATGTTCTCCGGAAGGTCCCTCCTCCTTTGGGGTGTCCTGCTTGGCGCTGCTTTATCAGTTGCCCGGCCCCCTTCCACCCTCCCTGATGAAGTCGCCCCTAAAACCAAAACGGAAGTGGAGCCATATTCAGCTCGGCCAGGAGACACAGTAACTTTGCAGTGCAGGCTTCGAGAAGATGTTCAGAGCATCAGCTGGGTGAAAAATGGAGTTCAGCTTTTGGAGACTAACCGCACGCGCATAACAGGGGAGGAGATCCAAATTTCCAACGCAGGGCCGGAGGACAATGGGCTGTATGCCTGTGTTACTATCGGGCCTTCTGGAACATATACAGTATTATTCTCCATTAATGTATCAGATGCGCAGCCTTCGGCCGAGGACGACGATGATGATGATGACAATTCATCCTCTGAGGAGAAAGCTTCGGAGAACTCCAAACCGAACCGTCCCTTTTGGTCACACCCAGAAAAGATGGAGAAGAAGCTTCATGCCGTGCCGGCAGCAAAAACGGTGAAATTTAGGTGTCCGGCAAATGGCACTCCATCGCCCGCACTTCGCTGGTTGAAGAATGGCAAGGAGTTCCGACCCGATCAGCGCATTGGTGGATATAAGGTCCGTTCTCAAACATGGAGCCTTATTATGGGATTCCGTTGTCCCATCTGATAAAGGGAAATACACTTGTATTGTGGAGAACAAGTATGGCACCCTCAACCACACGTACCANTTTGGATGTTGTCGAGCGTTCCCCACACCGGCCCTAATCTACAAGCCGGGTCTCCCAGCCAAATACAGGTGTTACTGGTGGGAAGCAACGGCCGATTTTTCCTGGCAAAGTGGAAAAGGCGACCCCCAGCCCTCAAATTCCAGTTGCCTCAAGGCCCAATAGAAGAATAAACGGCCAGT
  5   1   1       add Neu7      out                        XL003g02.5p                                                                                                                                                                                                                                                                                                                                                                   NAAGAAACTAAACATTTGGAAACAGGNAGCTGTGTGAGGCTTGTCTCGTGCCTGACACTGGAGGTCTCATGGATTTCGGCTGTGTGCACTAGCCAACTTGGGATGTTCTCCGGAAGGTCCCTCCTCCTCTGGGGTGTCCTGCTTGGAGCTGCTTTATCAGTTGCCCGGCCCCCTTCCACCCTCCCCGACCAAGATGCACTGCCTTCGGCCGAGGACGATGATGAAGATGATGACAATTCATCCTCTGAGGAGAAAGCTGCAGAAAACTCCAAACCGAACCGTCCACTTTGGTCACATCCAGAAAAAATGGAGAAGAAGCTTCATGCAGTGCCAGCAGCAAAAACTGTAAAATTTAGGTGTCCAGCAAATGGAACTCCAACGCCAACACTTCGCTGGCTGAAGAATGGCAGGGCGTTCCAACAAGATCAGCGCATTGGTGGATATAAGGTCCGGTCTCAAACATGGAGTCTTATTATGGATTCCGTTGTCCCATCTGATAAAGGAAATTACACCTGTATTGTGGAGAACAAGTATGGTGCCATCAACCACACATACCAGTTAGATGTTGTTGAGCGTTCCCCACACCGCCCAATCCTACAAGCCGGTCTCCCAGCGAATACAAGCGTTACTG
  5   1   2      seed Ga12      out                        XL219d21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACGAGGCCCGATCAGCGCATTGGTGGATATAAGGTCCGTTCTCAAACATGGAGCCTTATTATGGATTCCGTTGTCCCATCTGATAAAGGAAATTACACTTGTATTGTGGAGAACAAGTATGGCACCCTCAACCACACGTACCAGTTGGATGTTGTCGAGCGTTCCCCACACCGCCCTATCCTACAAGCCGGTCTCCCAGCAAATACAAGTGTTACTGTGGGAAGCACCGCCGAGTTTTCCTGCAAAGTGTACAGCGACCCCCAGCCTCACATCCAGTGGCTCAGGCACATAGAGATTAACGGCAGTAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTGAAGTTGAGGACGATAAACCCGCACTTCTGGCCTCCCCTTTACAACTGGAGATTATCATCTACTGCACGGGGGCTGCCTTTGTGTCC
  5   1   2       bld Neu7      out                        XL032c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGTACCAGTTGGATGTTGTCGAGCGTTCCCCACACCGCCCTATCCTACAAGCCGGTCTCCCAGCAAATACAAGTGTTACTGTGGGAAGCACCGCCGAGTTTTCCTGCAAAGTGTACAGCGACCCCCAGCCTCACATCCAGTGGCTCAGGCACATAGAGATTAACGGCAGTAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGACAAGGATATGGAGGTTCTCCACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTGAAGTTGAGGACGATAAACCCGCACTTCTGGCCTCCCCTTTACAACTGGAGATTATCATCTACTGCACGGGGGCTGCCTTTGTGTCCGCCATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAGCTGGCTGTGCACAAGCTCGCCAAGAGCATCCCGCTGCGCAGACAGGTTTCAGGGGACTCCAACTCATCAATGCACTCTGGAGTGATATTGGTTAGGCCTTCGCGCCTTTCTTCCAGTGGGACACCCATGTTGTCTGGAGTCTCGGAATATGAGCTT
  5   1   2       bld Ga12      out                        XL173e13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGAGCGTTCCCCACACCGCCCTATCCTACAAGCCGGTCTCCCAGCAAATACAAGTGTTACTGTGGGAAGCACCGCCGAGTTTTCCTGCAAAGTGTACAGCGACCCCCAGCCTCACATCCAGTGGCTCAGGCACATAGAGATTAACGGCAGTAGAGTGGCCTCGGATGGCTTCCCGTATGTGGAGATCCTCAAGACTGCAGGAGTCAACACCTCGGA
  5   1   2       bld Emb1                            IMAGE:5154831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTGAGAAATGTTACTTTTGAGGATGCTGGCCAGTATACCTGCTTGGCCGCTAACTCCATTGGGATCTCTCATCATTCTGCATGGTTGACCGTTCTTGAAGTTGAGGACGATAAACCCGCACTTCTGGCCTCCCCTTTACAACTGGAGATTATCATCTACTGCACGGGGGCTGCCTTTGTGTCCGCCATGGTGGTCACCATCATTATCTTTAAAATGAAGCACCCGTCGAAGAAGTCGGACTTCAACAGCCAGCTGGCTGTGCACAAGCTCGCCAAGAGCATCCCGCTGCGCAGACAGGTAACAGTTTCAGGGGACTCCAACTCATCAATGCACTCTGGAGTGATATTGGTTAGGCCTTCGCGCCTTTCTTCCAGTGGGACACCCATGTTGTCTGGAGTCTCGGAATATGAGCTTCCGGAAGATCCACGATGGGAAGTGGCAAGGGACAGGCTGATCCTTGGGAAACCTCTCGGAGAAGGCTGCTTTGGGCAGGTAGTAATGGCGGAGGCTATAGGCCTGGACAAGGAGAAGCCTAACCGAGTAACAAAAGTCGCCTTGAAGATGCTGAAGTCTGATGCAAATGAAAAGGACCTGTCTGATCTGATTTCCGAGATGGAAATGATGAAAATGATTGGAAAACACAAAAATATCATTAATTTACTTGGTGCCCGCCACCCAGGACGGTCCCACTCCTATGTAATTGTCCAAATATGCTTCCACAGGGGAACCTGAAGAGAGTACTTTACGGGCCCAGACGCCCCGCCGGGTCATGGGAGTACCTGCCTAACAACCCTAATGGGTGCCCCCCCGAATCAGCTGCTTTTCCCTTCAAAGGAATCTGGGGGTCG
  5   1   1       add Emb3                            IMAGE:3400119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTAAACACCCAGCAGGTAGATGCCCCCCTGAATACATCCTCTCAGAGCAGAGTCAAAGCTGCTCTGCGTTTGTGTTCATAAGGTAACCCACCTCTTACTTCTGGAACAGGTTTCAGGGGACTCCAACTCATCAATGCACTCTGGAGTGATATTGGTTAGGCCTTCGCGTCTTTCTTCCAGCGGGACACCCATGTTGTCTGGAGTCTCGGAATATGAGCTTCCGGAAGATCCACGATGGGAAGTGGCAAGGGACAGGCTGATCCTTGGGAAACCTCTCCGGAAAGGCTGCTTTTGGCAGGTAGTAATGGCGGAGGCTATTGGCCTGGACCAGGAGAGGCCTAACCGAGTAACAAAAGTCGCCTTGAAGATGCTTAAGTCTGATGCAATGAANAGGACCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)