Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012787091 Xl3.1-IMAGE:3549547.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:3549547.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTACTGAACAGNAAGCATCACCACCACCACAGATTGCAGGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTGGAAAATTACCTCGCTCACAAAAAAGTTTTCCTGCCCTACTGCACCTCTACAGCAAAAAGCTATTCAGCAACTTCAGAAAATTAAAATCTCCTTCATCTGCTACTGGGAAGCCTGTAGATTATACT
                                                  Xl3.1-CHK-1012714963                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAACAGNAAGCATCACCACCACAACAGATTxxxxGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTGGAAAATTACCTCGCTCACAAAAAAGTTTTCCTGCCCTACTGCACCTCTACAGCAAAAAGCTATTCAGCAACTTCAGAAAATTAAAATCTCCTTCATCTGCTACTGGGAAGCCTGTAGATTATACTGTGAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     2     1     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PROTEIN --- Cf ---- 5e-033     NP_001121658.1 zinc finger protein, multitype 2 [Canis lupus familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 8e-047     NP_001034549.1 zinc finger protein, multitype 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-047     NP_722520.2 zinc finger protein, multitype 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 3e-047     XP_001478652.1 PREDICTED: similar to FOG [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-050     XP_414197.2 PREDICTED: similar to FOG [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 4e-052     XP_606758.3 PREDICTED: similar to friend of GATA-1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-118     Q9I9K0 Zinc finger protein FOG (Friend of GATA) (xFOG) [Xenopus laevis]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:3549547.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2       bld Tbd3                            IMAGE:3549546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTACTGAACAGNAAGCATCACCACCACAGNAAGATGCAGGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGGGGCACAACTTGCTGACTACCATGAATGCACC
  5   1   2      seed Tbd3                            IMAGE:3549547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACCACCACAGATTTTCAGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGC
  5   1   2       bld Tbd3                   IMAGE:3549546-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTGGAAAATTACCTCGCTCACAAAAAAGTTTTCCTGCCCTACTGCACCTCTACAGCAAAAAGCTATTCAGCAACTTCAGAAAATTAAAATCTCCTTCATCTGCTACTGGGAAGCCTGTAGATTATACTGTGAAGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)