Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 0%

 1012787091 Xl3.1-IMAGE:3549547.5 - 3 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:3549547.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTACTGAACAGNAAGCATCACCACCACCACAGATTGCAGGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTGGAAAATTACCTCGCTCACAAAAAAGTTTTCCTGCCCTACTGCACCTCTACAGCAAAAAGCTATTCAGCAACTTCAGAAAATTAAAATCTCCTTCATCTGCTACTGGGAAGCCTGTAGATTATACT
                                                  Xl3.1-CHK-1012714963                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAACAGNAAGCATCACCACCACAACAGATTxxxxGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTGGAAAATTACCTCGCTCACAAAAAAGTTTTCCTGCCCTACTGCACCTCTACAGCAAAAAGCTATTCAGCAACTTCAGAAAATTAAAATCTCCTTCATCTGCTACTGGGAAGCCTGTAGATTATACTGTGAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     2     1     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PROTEIN --- Cf ---- 5e-033     NP_001121658.1 zinc finger protein, multitype 2 [Canis lupus familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 8e-047     NP_001034549.1 zinc finger protein, multitype 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-047     NP_722520.2 zinc finger protein, multitype 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 3e-047     XP_001478652.1 PREDICTED: similar to FOG [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-050     XP_414197.2 PREDICTED: similar to FOG [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 4e-052     XP_606758.3 PREDICTED: similar to friend of GATA-1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-118     Q9I9K0 Zinc finger protein FOG (Friend of GATA) (xFOG) [Xenopus laevis]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:3549547.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2       bld Tbd3                            IMAGE:3549546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTACTGAACAGNAAGCATCACCACCACAGNAAGATGCAGGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGGGGCACAACTTGCTGACTACCATGAATGCACC
  5   1   2      seed Tbd3                            IMAGE:3549547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACCACCACAGATTTTCAGAGGAGAGAGCAGTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGC
  5   1   2       bld Tbd3                   IMAGE:3549546-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGCGCCAGTAGTTACAGTGAAACTAGAGGAGAACTCTGGCATGGATTGTGAAGGAGCAGGAAGTGATCATGTGAGTGAGGGCAGTCAGAGCCCCAGCTCCTTAGACGATCCAGACGAAGACCCAAACCGGACAGTTTGCGAGGCATGCAACATCCGTTTTAGTCGCCATGAGACATATGTAGTGCACAAACGGCACTACTGTGCATCACGACATGACCCACCATTGCGTCGTAGTGGAGTAAACAAACTTGGGCCTCCGTATGCCACTCAGCCAACTCCACGCACACGGAAACGGCGTAAGTTATATGAAATTCATGGTGTTGCTCCAACAGAATCCACCCTTTCCTCACCACATCCACTGGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTGATACCTGCACCTGCTATGCCTTCCCCAAGTTCTAGTCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGCTTGGTGGCAGAAGTACCAGCTCCATCTGCAGCTGCCACTGTGGCACAACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTGGAAAATTACCTCGCTCACAAAAAAGTTTTCCTGCCCTACTGCACCTCTACAGCAAAAAGCTATTCAGCAACTTCAGAAAATTAAAATCTCCTTCATCTGCTACTGGGAAGCCTGTAGATTATACTGTGAAGGT

In case of problems mail me! (