Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:6636578.5                      26 END     1          14        3                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6639364.5                      11 PI      89        269      956                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012787124 Xl3.1-IMAGE:8321061.5 - 7 ESTs
                                                                       .-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8321061.5                                GTTCCAGGCAGGGGGATACGGGAGTCGATTCTCCTTGCGGCTGGAGTTAACATGTGGGGCTGCCCGGTGCCTCTGATACGGAGCTAGAGGAGAGTGAGTTTGGAGAGTGCTAACCCCTGCCCCAGTAATCAGGAGACTGCCAGAGACTGCACGGGTCTGAACTTACCTGCAACTGCTGGATGTGCCTTTATAAACTGCTGCCCCCGGGCACCGCTGGAAGGAAAGTTAGAGGCGCTGCCCTGCTGGTGGGCATTGTGCTGCCACTTTAAAGGTGAAAGGATGTTTCCGGCAGAAATCCCAGACTTGCCCACTTGACACAACGCGGCCCTGGACGTCCATGAACCCATCATGCTTTGCTCCTGCCGCAGTAAATCCAAATTCCTGGCCCTCACCTTATTGCTGCTGTCGGCTGCCACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCGTCTCTGGGGCCGGTAGCCCCACATTTCTCGGCCACGTCATTGTTCCAGGTGGAGTTGGAGAGTCGCCTGCGGGAAGCCGAGGAAGAGAATAGGAGACTGCGCCAGCAACTGGGGGAGATTAGGAACGAGGAGCAAAGCCCCGGAGGTGGGACTGAAGGAGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCAATAGTCTGTGCCGGCCATTACAACAACCGAGATGTGGTGACCCTGGTGAAGTCCATTCTCTTTCCAAGGAGAAACCCGTTACATCTGCACCTGATCACGGATGATGTTGCTCTGGAATGTTGCTCCAACCTGTTCAACACGTGGATGGTGCCGTCTCTAACGATCAGCTTCTATAATGCCAGTGAGCTAAAGCCGGACGTCGCATGGATCCCAAACAAACACTACTCGGGAATATTCGGGCTGCTGAAGCTCACACTGACCAAGGCGCTACCCTCCGACCTCTCCAAAGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAATTCACAGGCGAGCAGGTACTGGGGCTAGTGGAGAATCAGAGCGACTGGTACTTGGGTAACCTCTGGAAAAACCACAAGCCGTGGCCTGCCTTAGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTTTTGGACAAGCTGCGTCTGATTGGATGGGAGGAGATGTGGCGGCTGACGGCAGAGAGGGAGCTGATGAATATGCTGAGCACTTCGCTGGCTGACCAG
                                                  Xl3.1-CHK-1012699415                                      GGCAGGGGGATACGGGAGTCGATTCTCCTTGCGGCTGGAGTTAACATGTGGGGCTGCCCGGTGCCTCTGATACGGAGCTAGAGGAGAGTGAGTTTGGAGAGTGCTAACCCCTGCCCCAGTAATCAGGAGACTGCCAGAGACTGCACGGGTCTGAACTTACCTGCAACTGCTGGATGTGCCTTTATAAACTGCTGCCCCCGGGCACCGCTGGAAGGAAAGTTAGAGGCGCTGCCCTGCTGGTGGGCATTGTGCTGCCACTTTAAAGGTGAAAGGATGTTTCCGGCAGAAATCCCAGACTTGCCCACTTGACACAACGCGGCCCTGGACGTCCATGAACCCATCATGCTTTGCTCCTGCCGCAGTAAATCCAAATTCCTGGCCCTCACCTTATTGCTGCTGTCGGCTGCCACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCGTCTCTGGGGCCGGTAGCCCCACATTTCTCGGCCACGTCATTGTTCCAGGTGGAGTTGGAGAGTCGCCTGCGGGAAGCCGAGGAAGAGAATAGGAGACTGCGCCAGCAACTGGGGGAGATTAGGAACGAGGAGCAAAGCCCCGGAGGTGGGACTGAAGGAGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCAATAGTCTGTGCCGGCCATxACAxCAACCGAGATGTGGTGACCCTGGTGAAGTCCATTCTCTTTCxxAGGAGAAACCCGTTACATCTGCACCTGATCACGGATGATGTTGCTCTGxxxxxxxxxxxxAACCTGTTCAACACGTGGATGGTGCCGTCTCTAACGATCAGCTTCTATAATGCCAGTGAGCTAAAGCCGGACGTCGCATGGATCCCAAACAAACACTACTCGGGAATATTCGGGCTGCTGAAGCTCACACTGACCAAGGCGCTACCCTCCGACCTCTCCAAAGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAATTCACAGGCGAGCAGGTACTGGGGCTAGTGGAGAATCAGAGCGACTGGTACTTGGGTAACCTCTGGAAAAACCACAAGCCGTGGCCTGCCTTAGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTTTTGGACAAGCTGCGTCTGATTGGATGGGAGGAGATGTGGCGGCTGACGGCAGAGAGGGAGCTGATGAATATGCTGAGCACTTCGCTGGCTGACCAGGATATA
                                                      consensus depths                                     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     3     4     2     4     2     4     2     4     2     4     2     4     1     3     2     4     2     4     1     4     2     4     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     348     886                                
                                               BLH MIN     348     117                                
                                               BLH MPR     135     117                                
                                               BLH OVR     348     810                                
                                               ORF LNG     348      19                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 8e-007     NP_001097911.1 CG9996 CG9996-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 4e-008     XP_319364.4 AGAP010187-PA [Anopheles gambiae str. PEST] ---------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 1e-008     XP_874977.3 PREDICTED: similar to glycosyltransferase 8 domain containing 3 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 7e-038     NP_509833.2 LARGE (mouse dystroglycan glycosylation) homolog family member (lge-1) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ==== 3e-074     XP_001192605.1 PREDICTED: similar to glycosyltransferase-like 1B [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 8e-108     NP_598397.1 like-glycosyltransferase; acetylglucosaminyltransferase-like protein [Homosapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                             PREDICTED - Cf ---- 7e-108     XP_531751.2 PREDICTED: similar to like-glycosyltransferase [Canis familiaris] --------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 3e-108     NP_034817.1 like-glycosyltransferase; myodystrophy [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Bt ==== 9e-109     XP_582913.3 PREDICTED: similar to acetylglucosaminyltransferase-like protein [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 2e-111     NP_001004538.1 glycosyltransferase-like 1B [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 2e-113     NP_001004404.1 acetylglucosaminyltransferase-like protein [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Xt ==== 3e-160     NP_001096468.1 hypothetical protein LOC100125087 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 4e-170     NP_001089877.1 glycosyltransferase-like 1B [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8321061.5                                                                                   ATG------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TGA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld Emb1 5g                         IMAGE:6631809.5p GGGATTTAACCAGTGTTATGGTGGAATCAGTGTTCCAGGCAGGGGGATACGGGAGTCGATTCTCCTTGCGGCTGGAGTTAACATGTGGGGCTGCCCGGTGCCTCTGATACGGAGCTAGAGGAGAGTGAGTTTGGAGAGTGCTAACCCCTGCCCCAGTAATCAGGAGACTGCCAGAGACTGCACGGGTCTGAAGTTACCTGCAACTGCTGGATGTGCCTTTATAAACTGCTGCCCCCGGGCACCGCTGGAAGGAAAGTTAGAGGCGCTGCCCTGCTGGTGGGCATTGTGCTGCCACTTTAAAGGTGAAAGGATGTTTCCGGCAGAAATCCCAGACTTGCCCACTTGACACAACGCGGCCCTGGACGTCCATGAACCCATCATGCTTTGCTCCTGCCGCAGTAAATCCAAATTCCTGGCCCTCACCTTATTGCTGCTGTCGGCTGCCACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCGTCTCTGGGGCCGGTAGCCCCACATTTCTCGGCCACGTCATTGTTCCAGGTGGAGTTGGAGAGTCGCCTGCGGGAAGCCGAGGAAGAGAATAGGAGACTGCGCCAGCAACTGGGGGAAATTAGGAACGAGGAGCAAAGCCCCGGAGGTGGGACTGAAGGAGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCAATAGTCTGTGCCGGCCATAACAGCAGCCNGAAATGTGGTGACCCCTGGTTGAAAGTCCATTCTCTTNCCACAGGGAGAAACCCCNGTTACATTCTGCACCNNTGATCACGGAATGAATGTTGCTCCTGCCGNTGTGGCTGGAGGAACCCTGTTCCAACCACCGTGGAATGGGTGGCCCATCTCTAANNCGATCAAGCTTCCTATAANTGCC
  5   1   2      skin Egg1 5g                            PBX0058B01.5p                                GTTCCAGGCAGGGGGATACGGGAGTCGATTCTCCTTGCGGCTGGAGTTAACATGTGGGGCTGCCCGGTGCCTCTGATGCGGAGCTAGAGGAGAGTGAGTTTGGAGAGTGCTAAACCCTCCCCCAGTAATCAGGAGACTGCCAGAGACTGCACGGGTCTGAACTTACCTGCAACTGCTGGATGTGCCTTTATAAACTGCTGCCCCCGGGCACCGCTGGAAGGAAAGTTAGAGGCGCTGCCCTGCTGGTGGGCATTGTGCTGCCACTTTAAAGGTGATAGGATGTTGCCGGCAGAAATCCCAGACTTGCCCACTTGACACAACGCGGCCCTGGACGTCCATGAACCCATCATGCTTTGCTCCTGCCGCAGTAAATCCAAATTCCTGGCCC
  5   1   2       add Egg6 5g                IMAGE:4436055-IMAGp.IMAGp                                                                                                                                              AAACCCTCCCCCAGTAATCATGGAGAATGCCACAGACTGCACGGGTCTGAACTTACCTGCAACTGCTGGATGTGCCTTTATAAACTGCTGCCCCCGGGCACCGCTGGAAGGAAAGTTAGAGGCGTTGCCCTGCTGGTGGGCATTGTGCTGCCACTTTAAAGGTGATAGGATGTTTCCGGCAGAAATCCCCGACTTGCCCACTTGACCCACCGCGGCCCTGGACGTCCATGAACCCATCATGCTTTGCTCCTGCCGCAGTAAATCCAAATTCCTGGCCCTCACCTTATTGCTGCTGTCGG
  5   1   2      seed Em10 5g                         IMAGE:8321061.5p                                                                                                                                                                 CAGGAGACTGCCAGAGACTGCACGGGTCTGAACTTACCTGCAACTGCTGGATGTGCCTTTATAAACTGCTGCCCCCGGGCACCGCTGGAAGGAAAGTTAGAGGCGCTGCCCTGCTGGTGGGCATTGTGCTGCCACTTTAAAGGTGAAAGGATGTTTCCGGCAGAAATCCCAGACTTGCCCACTTGACACAACGCGGCCCTGGACGTCCATGAACCCATCATGCTTTGCTCCTGCCGCAGTAAATCCAAATTCCTGGCCCTCACCTTATTGCTGCTGTCGGCTGCCACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCGTCTCTGGGGCCGGTAGCCCCACATTTCTCGGCCACGTCATTGTTCCAGGTGGAGTTGGAGAGTCGCCTGCGGGAAGCCGAGGAAGAGAATAGGAGACTGCGCCAGCAACTGGGGGAGATTAGGAACGAGGAGCAAAGCCCCGGAGGTGGGACTGAAGGAGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCAATAGTCTGTGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTCTTTCACAGGAGAAACCCGTTACATCTGCACCTGATCACGGATGATGTTGCTCTGCGTGTGCTG
  5   1   2       bld Em10 5g                         IMAGE:7982297.5p                                                                                                                                                                         ATCGAGGAGAGTGTGGGATTTAACCAGTGTTATGGTGGAATCAGTGTTCCAGGCAGGGGGATACGGGAGTCGATTCTCCTTGCGGCTGGAGTTAACATGTGGGGCTGCCCGGTGCCTCTGATACGGAGCTAGAGGTGAAAGGATGTTTCCGGCAGAAATCCCAGACTTGCCCACTTGACACAACGCGGCCCTGGACGTCCATGAACCCATCATGCTTTGCTCCTGCCGCAGTAAATCCAAATTCCTGGCCCTCACCTTATTGCTGCTGTCGGCTGCCACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCGTCTCTGGGGCCGGTAGCCCCACATTTCTCGGCCACGTCATTGTTCCAGGTGGAGTTGGAGAGTCGCCTGCGGGAAGCCGAGGAAGAGAATAGGAGACTGCGCCAGCAACTGGGGGAGATTAGGAACGAGGAGCAAAGCCCCGGAGGTGGGACTGAAGGAGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCAATAGTCTGTGCCGGCCATTACAACAACCGAGATGTGGTGACCCTGGTGAAGTTCATTCTCTTTCCACAGAGAAACCGTTACATCTGCCCCTGATCCCGGATGATGTTGCCCTGCGTGTGCTGAAGAACCTGTTCAACACGTGGATGGTGCCATCTCTAACGATCAGCTTCTATAATGCCAGGA
  5   1   2      skin Em10                            IMAGE:8317480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCTGGTGAAGTCCATTCTCTTCCACAGGAGAAACCCGTTACATCTGCACCTGATCACGGATGATGTTGCTCTGCGTGTGCTGAGGAACCTGTTCAACACGTGGATGGTGCCGTCTCTAACGATCAGCTTCTATAATGCCAGTGAGCTAAAGCCGGACGTCGCATGGATCCCAAACAAACACTACTCGGGAATATTCGGGCTGCTGAAGCTCACACTGACCAAGGCGCTACCCTCCGACCTCTCCAAAGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAATTCACAGGCGAGCAGGTACTGGGGCTAGTGGAGAATCAGAGCGACTGGTACTTGGGTAACCTCTGGAAAAACCACAAGCCGTGGCCTGCCTTAGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTTTTGGACAAGTTGCGCCTGATTGGATGGGAGGAGATGTGGCGGCTGACAGCAGAGAGGGAGCTGATGAATATGCTGAGCACTTCACTGGCTGACCAGGTCATTCACTGGAATTCCCCCCACAAGCTCCGCGTCAAGAACAAACACGTTGAACTTTTCCGCACCCTGTACCTCACTTTCCTGGAGTACGACGGGAGCCTCCTGCGCCGGGAGCTGATTGGCTGTCCCAGTGAAGGGGAACAGCAGGGGGGCAGCCCAGCTGCTCTGTCGCATTTGACCAGGAAGATCATGCTA
  5   1   1       add DMZ       out                        xl238m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAACCTGGTTCAACACCTGGATGGTGCCGTCCCTGCAGATCAGCTTCTATAATGCGAGTGAGCTGAAGCCGGACGTCGCATGGATCCCAAACAAACACTACTCCGGAATATACGGCTTGCTGAAGCTCACACTGACCAAGGCGCTACCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATCGCCGAGCTCTGGGCAATCTTTAAGAAATTCACAGGTGAGCAGGTTCTGGGTCTAGTGGAGAATCAGAGTGACTGGTACTTGGGTAACCTCTGGAAGAACCACAAGCCGTGGCCTGCCTTAGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTTTTGGACAAGCTGCGTCTGATTGGATGGGAGGAGATGTGGCGGCTGACGGCAGAGAGGGAGCTGATGAATATGCTGAGCACTTCGCTGGCTGACCAGGATATATTTAATGCAGTTATCAAGAGTTCCCCTACTCTGGTGTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGTGAACTGGCCGATCTCAAGGTCATTCACTGGAATTCCCCCCACAAGCTCCGAGTCAAGAACAAACACGTTGAACTTTTCCGCACCCTGTACCTCACTTTCCTAGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)