Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012787262 Xl3.1-IMAGE:6865256.5 - 4 ESTs
                                                                       ....-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6865256.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCAGCGCAGGGAGCAGATCTCTGGCTCAGGACTATGAGCAGCTACTAGTGCCGCCAGCGCCTCATTGTGCAGCAGGAGCCCGGCCTGAGGCCTGTGAAACGCGCCACCATGAGTGGGGTCCTAAAGCGCAAATACCAGGCGTTGGAAGAGGACACCAATTACTCGTCATCCTCCGCCTCGCCGTCCTCCTCCCTGACGTCATCAGGCAGCGACTTGGACGAGGACTACAGCTACGACGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTGAAGAAAGAGAAGCGCTTTAAAAAGAACAAGGTGGTGTTCGACCAAGTGGGGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGGGGCTGCACTCTCGGAATGAAGCGAAGGCATAGCTACAGCCGGCAGTTCACATTGGAAGAGTTCTCCAAGGAGCAACTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAGCTGGAGTCGCTGAAGAACATGCTAACCCTAAATGGTACCATTGTATCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGCATGTATCCGCCCAAGGAACGGCGGGCTTTGCTTAAAAGCGAAGGCATCAAGAAGATCGACAAATCTGAGAAATACGAGCTCAATGAAATCCGACGCTCCAGGGAAGACTGCGGGTGCAACTGTCAGGATTTTTGTGACCCGGAGACCTGCAGCTGTAACATTGCCGGGATCAAGTGTCAGAGGGACCATTCGATGTTCCCGTGCGGCTGTACAAAAGATGGTTGCGGCAACCCAAACGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCATCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACAACCGCAGATTAGAAACCGATGAAA
                                                  Xl3.1-CHK-1012707558                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCAGGGAGCAGATCTCTGGCTCAGGACTATGAGCAGCTACTAGTGCCGCCAGCGCCTCATTGTGCAGCAGGAGCCCGGCCTGAGGCCTGTGAAACGCGCCACCATGAGTGGGGTCCTAAAGCGCAAATACCAGGCGTTGGAAGAGGACACCAATTACTCGTCATCCTCCGCCTCGCCGTCCTCCTCCCTGACGTCATCAGGCAGCGACTTGGACGAGGACTACAGCTACGACGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTGAAGAAAGAGAAGCGCTTTAAAAAGAACAAGGTGGTGTTCGACCAAGTGGGGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGGGGCTGCACTCTCGGAATGAAGCGAAGGCATAGCTACAGCCGGCAGTTCACATTGGAAGAGTTCTCCAAGGAGCAACTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAGCTGGAGTCGCTGAAGAACATGCTAACCCTAAATGGTACCATTGTATCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGCATGTATCCGCCCAAGGAACGGCGGGCTTTGCTTAAAAGCGAAGGCATCAAGAAGATCGACAAATCTGAGAAATACGAGCTCAATGAAATCCGACGCTCCAGGGAAGACTGCGGGTGCAACTGTCAGGATTTTTGTGACCCGGAGACCTGCAGCTGTAACATTGCCGGGATCAAGTGTCAGAGGGACCATTCGATGTTCCCGTGCGGCTGTACAAAAGATGGTTGCGGCAACCCAAACGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCATCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACAACCGCAGATTAGAAACCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1     1     1     1     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     110     259                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN      71     106                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR     110     181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG     110      12                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 2e-008     XP_320005.4 AGAP009226-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 8e-018     NP_491368.2 C41D11.3 [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 7e-055     NP_722800.1 CG4272-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 2e-057     XP_001186247.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ==== 3e-079     XP_542715.2 PREDICTED: similar to AXIN1 up-regulated 1 [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Bt ==== 4e-080     NP_001091504.1 AXIN1 up-regulated 1 [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 5e-084     NP_079245.2 TGF-beta induced apotosis protein 2 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 6e-085     NP_848749.1 cysteine-serine-rich nuclear protein 3 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 1e-097     NP_955913.1 Unknown (protein for MGC:66340) [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 9e-111     XP_418530.2 PREDICTED: hypothetical protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 5e-165     NP_001072461.1 AXIN1 up-regulated 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Xl ==== 5e-173     NP_001088060.1 hypothetical protein LOC494755 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6865256.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------TAG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2      seed Emb1 5g                         IMAGE:6865256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCAGCGCAGGGAGCAGATCTCTGGCTCAGGACTATGAGCAGCTACTAGTGCCGCCAGCGCCTCATTGTGCAGCAGGAGCCCGGCCTGAGGCCTGTGAAACGCGCCACCATGAGTGGGGTCCTAAAGCGCAAATACCAGGCGTTGGAAGAGGACACCAATTACTCGTCATCCTCCGCCTCGCCGTCCTCCTCCCTGACGTCATCAGGCAGCGACTTGGACGAGGACTACAGCTACGACGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTGAAGAAAGAGAAGCGCTTTAAAAAGAACAAGGTGGTGTTCGACCAAGTGGGGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGGGGCTGCACTCTCGGAATGAAGCGAAGGCATAGCTACAGCCGGCAGTTCACATTGGAAGAGTTCTCCAAGGAGCAACTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAGCTGGAGTCGCTGAAGAACATGCTAACCCTAAATGGTACCATTGTATCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGCATGTATCCGCCCAAGGAACGGCGGGCTTTGCTTAAAAGCGAAGGCATCAAGAAGATCGACAAATCTGAAGAATACGAGCTCAATGAAATCCGACGCTCCAGGGAAGACTGCGGGGTGCAACTGGTCAGGATTTTTTGTGACCCGGGAGACCTGCAGGCTGTAACATTTGCCGGGGGATCAAAGTGNTCAGGAGGGGAACT
  5   1   2       bld Egg1 5g                            PBX0141F04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAGATCTCTGGCTCAAGACTATGAGCAGCTACTAGTGCCGCCAGCGCCTCATTGTGCAGCAAGAGCCCGGCCTGAGGCCTGTGAAACGCGCCACCATGAGTGGGGTCCTAAAGCGCAAATACCAGGCGTTGGAAGAGGACACCAATTACTCGTCATCCTCCGCCTCGCCGTCCTCCTCCCTGACGTCATCAGGCAGCGACTTGGATGAGGACTACAGCTACGACGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTGAAGAAAGAGAAGCGCTTTAAAAAGAACAAGGTGGTGTTCGACCAAGTGGGGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGGGGCTGCACTCTCGGAATGAAGCGAAGGCATAGCTACAGCCGGCAGTTCACATTGGAAGAGTTCTCCAAGGAGCAACTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAGCTGGAGTCGCTGAAGAACATGCTAACCCTAAATGGTACCATTGTATCTCAAAAAGCCAACAACCTCTCCATCGACGACATCT
  5   1   2       bld Ga12 5x3  out                        XL192c19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCGCCAGCGCCTCATTGTGCAGCAGGAGCCCGGCCTGAGGCCTGTGAAACGCGCCACCATGAGTGGGGTCCTAAAGCGCAAATACCAGGCGTTGGAAGAGGACACCAATTACTCGTCATCCTCCGCCTCGCCGTCCTCCTCCCTGACGTCATCAGGCAGCGACTTGGACGAGGACTACAGCTACGACGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTGAAGAAAGAGAAGCGCTTTAAAAAGAACAAGGTGGTGTTCGACCAAGTGGGGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGGGGCTGCACTCTCGGAATGAAGCGAAGGCATAGCTACAGCCGGCAGTTCACATTGGAAGAGTTCTCCAAGGAGCAACTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAGCTGGAGTCGCTGAAGAACATGCTAACCCTAAATGGTACCATTGTATCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCG
  5   1   2       bld Bla1      out                   IMAGE:3380595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGCATGTATCCGCCCAAGGAACGGCGGGCTTTGCTTAAAAGCGAAGGCATCAAGAAGATCGACAAATCTGAGAAATACGAGCTCAATGAAATCCGACGCTCCAGGGAAGACTGCGGGTGCAACTGTCAGGATTTTTGTGACCCGGAGACCTGCAGCTGTAACATTGCCGGGATCAAGTGTCAGAGGGACCATTCGATGTTCCCGTGCGGCTGTACAAAAGATGGTTGCGGCAACCCAAACGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCATCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACAACCGCAGATTAGAAACCGATGAAACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)