Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4741050-IMAGp.5                15 END     1          25        6                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:4741050-IMAGp.5                15 PI      93         76      959                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012787388 Xl3.1-IMAGE:6643750.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6643750.5 GAATTCCTGGGATGTGGGAAGGGGGCAGGCACAGAGGGGTTGCTGCATTGCAGCCTTCATTTGCTAGCGAATATATTAACAATGGCGACTTCCAACCCCAGCGGCAGCAGTGGAACCAGTGCGGGCCTCGGGTTCCAAGGACAGTCCCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACTTCTGTGAGAATACACAAAGTAAACGCAAAGCACTGAAGTTGAATTTTGCCAACCCAGCCTTCAAAACGACTGCAAAATTCACCCTGAACACCACTATCCAGAGTACCCACATGATGCACAAACCGGACCCTATCAGAAAACTTGAGACGACGTATCAAAAACAGGATTTGCGGACATCTAGCGTGAAGGTGTTAAGCTCAAATGAACAGGCGACCAAAAACAGGCTAGAGAGATTGCGGACACACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGATTTGAAGGACCTAGGGGAGATTGGCCGAGGCGCTTATGGCTCTGTTAATAAAATGAGTCATACTCCCAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTGATGGATCTGGATGTGGTGATGAGGAGTAGTGACTGTCCGTACATAGTCCAGTTCTACGGGGCGCTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTTGACAAGTTTTACAAATATGTATATTGTAGTTTAGATGACATTATTCCAGAGGAAATCTTANGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGATATCAAACCCTTCTCCATATTCTCCGGACACAAATGGAAACATTAAACTCTGTGACTTTTGGCATTAGCGGGG
                                                  Xl3.1-CHK-1012709612       CTGGGATGTGGGAAGGGGGCAGGCACAGAGGGGxTxCTGCATTGCAGCCTTCATTTGCTAGCGAATATATTAACAATGGCGACTTCCAACCCCAGCGGCAGCAGTGGAACCAGTGCGGGCCTCGGGTTCCAAGGACAGTCCCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACTTCTGTGAGAATACACAAAGTAAACGCAAAGCACTGAAGTTGAATTTTGCCAACCCAGCCTTCAAAACGACTGCAAAATTCACCCTGAACACCACTATCCAGAGTACCCACATGATGCACAAACCGGACCCTATCAGAAAACTTGAGACGACGTATCAAAAACAGGATTTGCGGACATCTAGCGTGAAGGTGTTAAGCTCAAATGAACAGGCGACCAAAAACAGGCTAGAGAGATTGCGGACACACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGATTTGAAGGACCTAGGGGAGATTGGCCGAGGCGCTTATGGCTCTGTTAATAAAATGAGTCATACTCCCAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTGATGGATCTGGATGTGGTGATGAGGAGTAGTGACTGTCCGTACATAGTCCAGTTCTACGGGGCGCTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTTGACAAGTTTTACAAATATGTATATTGTAGTTTAGATGACATTATTCCAGAGGAAATCTTANGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGATATCAAACCCTTCxxxATxxNxxCxGGACACAAATGGAAACATTAAACTCTGTGACTTTTGGCATTA
                                                      consensus depths      1     1     1     1     1     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1
                                               BLH MIN      15     119 
                                               BLH MPR      15     119 
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 8e-039     NP_509322.2 enhanced Susceptibility to Pathogens ESP-2, SAPK/ERK kinase, mitogen-activatedprotein kinase kinase, mediates Ca2+ signaling to determine neuronal asymmetricdevelopment (38.7 kD) (sek-1) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 1e-046     XP_314266.4 AGAP003365-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN --- Dm ---- 5e-055     NP_477353.1 MAP kinase kinase 4 CG9738-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 8e-057     XP_001179466.1 PREDICTED: similar to SEK1 [Strongylocentrotus purpuratus] ---==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Ci ---- 2e-063     NP_001071758.1 mitogen-activated protein kinase kinase [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PROTEIN --- Dr ---- 9e-093     NP_001082890.1 mitogen-activated protein kinase kinase 4B [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 6e-094     XP_415583.2 PREDICTED: similar to Mitogen-activated protein kinase kinase 4 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PREDICTED - Cf ---- 2e-093     XP_546627.1 PREDICTED: similar to Dual specificity mitogen-activated protein kinase kinase 4 (MAP kinase kinase 4) (JNK activating kinase 1) (c-Jun N-terminal kinase kinase 1) (JNKK) (SAPK/ERK kinase 1) (SEK1) [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Hs ==== 2e-096     NP_003001.1 mitogen-activated protein kinase kinase 4; dual specificity mitogen-activatedprotein kinase kinase 4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1;JNK activating kinase 1; SAPK/ERK kinase 1; MAPK/ERK kinase 4; JNK-activatedkinase 1 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Mm ==== 1e-096     NP_033183.1 mitogen activated protein kinase kinase 4; SAPK/Erk/kinase 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN === Bt ==== 3e-103     NP_001092508.1 mitogen-activated protein kinase kinase 4 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 3e-123     NP_001107157.1 mitogen-activated protein kinase kinase 4 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      PROTEIN === Xl ==== 5e-167     AAH70799.1 LOC431908 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6643750.5                                                                                  ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------TGA
                                                                   ORF                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2       bld Oo1                    IMAGE:3403996-IMAGp.IMAGp GAATTCCTGGGATGTGGGAAGGGGGCAGGCACAGAGGGGGTTGCTGTATTGCAGCCCTCATTTGCAGCGAATATATTAACAATGGCGACTTCCAACCCCATCGGCAGCAGTGGAACCAGTGCGGGCCTCGGGTTCCAAGGACAGTCCCAGCAACACAGCACCGTCAACAGCCTGCAGGGCCTTCAGATAAACTTCTGTGAGAATACACAAAGTAAACGCAAAGCACTGAAGTTGAATTTTGCCAACCCAGCCTTCAAAACGACTGCAAAATTCACCCTGAACA
  5   1   2      seed Oo1                             IMAGE:6643750.5p                GGAAGGGGGCAGGCACAGAGGGGGTTGCTGCATTGCAGCCTTCATTTGCTAGCGAATATATTAACAATGGCGACTTCCAACCCCAGCGGCAGCAGTGGAACCAGTGCGGGCCTCGGGTTCCAAGGACAGTCCCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACTTCTGTGAGAATACACAAAGTAAACGCAAAGCACTGAAGTTGAATTTTGCCAACCCAGCCTTCAAAACGACTGCAAAATTCACCCTGAACACCACTATCCAGAGTACCCACATGATGCACAAACCGGACCCTATCAGAAAACTTGAGACGACGTATCAAAAACAGGATTTGCGGACATCTAGCGTGAAGGTGTCAAGCTCAAATGAACAGGCGACCAAAAACAGGCTAGAGAGATTGCGGACACACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGATTTGAAGGACCTAGGGGAGATTGGCCGAGGCGCTTATGGCTCTGTTAATAAAATGAGTCATACTCCCAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTGATGGATCTGGATGTGGTGATGAGGAGTAGTGACTGTCCGTACATAGTCCAGTTCTACGGGGCGCTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTTGACAAGTTTTACAAATATGTATATTGGAGNTTTAGATGACATTATTCCAGAGGAAATCTTANGCAAAATCACTTTAGCGACTGTGAAAAGCCTTANATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGATATCAAACCCTTCCATATTCTCCTGG
  5   1   2       bld Oo1       out                   IMAGE:3403996.5p                                   GGGGGTTGCTGCATTGCAGCCTTCATTTGCTAGCGAATATATTAACAATGGCGACTTCCAACCCCAGCGGCAGCAGTGGAACCAGTGCGGGCCTCGGGTTCCAAGGACAGTCCCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACTTCTGTGAGAATACACAAAGTAAACGCAAAGCACTGAAGTTGAATTTTGCCAACCCAGCCTTCAAAACGACTGCAAAATTCACCCTGAACACCACTATCCAGAGTACCCACATGATGCACAAACCGGACCCTATCAGAAAACTTGAGACGACGTATCAAAAACAGGATTTGCGGACATCTAGCGTGAAGGTGTTAAGCTCAAATGAACAGGCGACCAAAAACAGGCTAGAGAGATTGCGGACACACAGTATTGAATCATCTGGAAAATGAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGATTTGAAGGACCTACGGGAGATTGGCCGAGGCGCTTATGGCTCTGTTAATAAAATGAGTTATACTCCCAGCCGGCAGATTATGGCTGATAAGATGATTCGGTACACAGTGGATGAGTAAGAACAGAAGCAGCTCGTGATGGAACTGGATGTG
  5   1   2       bld Emb4                            IMAGE:4681331.5p                                                                                                                        GACTTCCAACCCCAGCGGCAGCAGTGGAACCAGTGCGGGCCTCGGGTTCCAAGGACAGTCCCAGCAACACAGCACCGTCAACAGCATGCAGGGTAAACGCAAAGCACTGAAGTTGAATTTTGCCAACCCAGCCTTCAAAACGACTGCAAAATTCACCCTGAACACCACTATCCAGAGTACCCACATGATGCACAAACCGGACCCTATCAGAAAACTTGAGACGACGTATCAAAAACAGGATTTGCGGACATCTAGCGTGAAGGTGTTAAGCTCAAATGAACAGGCGACCAAAAACAGGCTAGAGAGATTGCGGACACACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGATTTGAAGGACCTAGGGGAGATTGGCCGAGGCGCTTATGGCTCTGTTAATAAAATGAGTCATACTCCCAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTGATGGATCTGGATGTGGTGATGAGGAGTAGTGACTGTCCGTACATAGTCCAGTTCTACGGGGCGCTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTTGACAAGTTTTACAAATATGTATATTGTAGTTTAGATGACATTATTCCAGAGGAAATCTTANGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGATATCAAACCCTTCAATATTCNTCCTGGACACAAATGGAAACATTAAACTCTGTGACTTTTGGCATTAGCGGGGCAGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)