Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012787837 Xl3.1-IMAGE:6957056.3 - 6 ESTs
                                                                       .........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6957056.3                              GGAATGGCACTCATCAATTTTACATTTACTTATTTTAAAGGTTTACTTATCCTTTAAGGGTTAAGATTTACAAAGCTGTTTTCTTAGCTGTAGCCTTTTGTTACAAAGCAGAAAATAGTTATTAAGTGCTTAATCATTTTGGAGGCTTTAAAATTCTGCGGATTTCAGTACTGCCACTGAGCTCTAACACCCACCAAGTCCAAGTGCTCAGGACAGTCAATGACATCCTGGTAAATTGACACTTTGGTTAAAAAAAAATTAAAAGCAATGAATATTTCAGAAAACAAATTAAACTTCTAAGAATTCCTCTGTATTCCCCAGTTAATAAAGCTGCCCCTTAGTGCGTTTGGTATTCAGAACATAAAATTTGATGTGATTCAGCTCCAACATTATTAAAAAGAAATGGTATTTCCCAAAGAAGTATATCACCTTTGTTTGACTCGCCCACATCTTCCAGAGAAAGTGGCTGGAATTGTATTTTTGCAGCCTTGTGTTGCATTGGAGCCCTAATTTGTCCGCTTCCCTCGAGAAGCCCATCTCCATAATATACACCTACACTGCTTGGTTTTGGGGTTTTATCCGCCCTCTAGAATGTGCTACACTTTCAGCCATTATCAATTACTGTTTGGTGTAGGCAATATGGAAAAAATGCCTTCTACAAAAAAATGGAGACTGGAGACCATAGTTGAACCTTACCCAAAATTGGTATCCATCTTTTCTTCAGCTTTCTCTGCCTTTGGCCTACTCATGGGTAGAGTGAAGTTTACGAACCTAGGGGTGTCTATATGTGTGACCTACTACATTTTCAACAGGTTTAAGGTGGGAAAAAAATGATCTTCTAAGGAATTTTTAGCACCTAGCTTTCCTGTATAATAAGACTAGTTTCCTCAGTGTATTAGACTTATGTTCAGCATTCCCTGTATGAGATTATTTGTTTGTTTTTTTTAATTATTTGTACAAGGACAGACCAGGAAAACATTGAATTTTGACACAAAGTTGTGATACGCAAGTGAAGACTGATCACCACTGTGGCAAGTGCTGATTTCAGCTCAAACA
                                                  Xl3.1-CHK-1012702381                                    GCACTCATCAATTTTACATTTACTTATTTTAAAGGTTTACTTATCCTTTAAGGGTTAAGATTTACAAAGCTGTTTTCTTAGCTGTAGCCTTTTGTTACAAAGCAGAAAATAGTTATTAAGTGCTTAATCATTTTGGAGGCTTTAAAATTCTGCGGATTTCAGTACTGCCACTGAGCTCTAACACCCACCAAGTCCAAGTGCTCAGGACAGTCAATGACATCCTGGTAAATTGACACTTTGGTTAAAAAAAAATTAAAAGCAATGAATATTTCAGAAAACAAATTAAACTTCTAAGAATTCCTCTGTATTCCCCAGTTAATAAAGCTGCCCCTTAGTGCGTTTGGTATTCAGAACATAAAATTTGATGTGATTCAGCTCCAACATTATTAAAAAGAAATGGTATTTCCCAAAGAAGTATATCACCTTTGTTTGACTCGCCCACATCTTCCAGAGAAAGTGGCTGGAATTGTATTTTTGCAGCCTTGTGTTGCATTGGAGCCCTAATTTGTCCGCTTCCCTCGAGAAGCCCATCTCCATAATATACACCTACACTGCTTGGTTTTGGGGTTTTATCCGCCCTCTAGAATGTGCTACACTTTCAGCCATTATCAATTACTGTTTGGTGTAGGCAATATGGAAAAAATGCCTTCTACAAAAAAATGGAGACTGGAGACCATAGTTGAACCTTACCCAAAATTGGTATCCATCTTTTCTTCAGCTTTCTCTGCCTTTGGCCTACTCATGGGTAGAGTGAAGTTTACGAACCTAGGGGTGTCTATATGTGTGACCTACTACATTTTCAACAGGTTTAAGGTGGGAAAAAAATGATCTTCTAAGGAATTTTTAGCACCTAGCTTTCCTGTATAATAAGACTAGTTTCCTCAGTGTATTAGACTTATGTTCAGCATTCCCTGTATGAGATTATTTGTTTGTTTTTTTTAATTATTTGTACAAGGACAGACCAGGAAAACATTGAATTTTGACACAAAGTTGTGATACGCAAGTGAAGACTGATCACCACTGTGGCAAGTGCTGATTTCAGCTCAAACACTTAGG
                                                      consensus depths                                   2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3
                                                 Xl3.1-IMAGE:6957056.3                                 ATG------------------------------------------------TAA---------------------------TAG---TAG------------------------------------------------------------------------------------TGA---------------------------------------ATG---------TAA---------------------------------ATG---------------------------TAA---------------------------------------------------------------------------------------------TAA------ATG------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------ATG---------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------TGA------------------------------------TAATAA---TAG---------------------ATG---------------ATG---------------------TAA---------------------------------------------------TGA---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                           ]
  5   1   2       bld Egg1                               PBX0124E10.5p GGCACGAGGAAAAAAATGTAAAATTGCTTGGAATGGCACTCATCAATTTTACATTTACTTATTTTAAAGGTTTACTTATCCTTTAAGGGTTAAGATTTACAAAGCTGTTTTCTTAGCTGTAGCCTTTTGTTACAAAGCAGAAAATAGTTATTAAGTGCTTAATCATTTTGGAGGCTTTAAAATTCTGCGGATTTCAGTACTGCCACTGAGCTCTAACACCCACCAAGTCCAAGTGCTCAGGACAGTCAATGACATCCTGGTAAATTGACACTTTGGTTaaaaaaaaaTTAAAAGCAATGAATATTTCAGAAAACAAATTAAACTTCTAAGAATTCCTCTGTATTCCCCAGTTAATAAAGCTGCCCCTTAGTGCGTTTGGTATTCAGAACATAAAATTTGATGTGATTCAGCTCCAACATTATTAAAAAGAAATGGTATTTCCCAAAGAAGTATATCACCTTTGTTTGACTCGCCCACATCTTCCAGAGAAAGTGGCTGGAATTGTATTTTTGCAGCCTTGTGTTGCATTGGAGCCCTAATTTGTCCGCTTCCCTCGAGAAGCCCATCTCCATAATATACACCTACACTGCTTGGTTTTGGGGTTTTATCCGCCCTCTAGAATGTGCTACACTT
  5   1   2       bld Egg1                               PBX0128D02.5p                              GGAATGGCACTCATCAATTTTACATTTACTTATTTTAAAGGTTTACTTATTCTTTAAGGGTTAAGATTTACAAAGCTGTTTTCTTAGCTGTAGCCTTTTGTTACAAAGCAGAAAATAGTTATTAAGTGCTTAATCATTTTGGAGGCTTTAAAATTCTGCGGATTTCAGTACTGCCACTGAGCTCTAACACCCACCAAGTCCAAGTGCTCAGGACAGTCAATGACATCCTGGTAAATTGACACTTTGGTTaaaaaaaaaTTAAAAGCAATGAATATTTCAGAAAACAAATTAAACTTCTAAGAATTCCTCTGTATTCCCCAGTTAATAAAGCTGCCCCTTAGTGCGTTTGGTATTCAGAACATAAAATTTGATGTGATTCAGCTCCAACATTATTAAAAAGAAATGGTATTTCCCAAAAAAGTATATCACCTTTGTTTGACTCGCCCACATCTTCCAGAGAAAGTGGCTGGAATTGTATTTTTGCAGCCTTGTGTTGCATTGGAGCCCTAATTTGTCCGCTTCCCTCGAGAAGCCCATCTCCATAATATACACCTACACTG
  3   1   2      seed Eye1      out                   IMAGE:6957056.3p                                                                                                                                                                                 ACCCAAGGTTTCCCAAAGGTGGCTTCCACGGGACCAGGTCCAAAATTGACCATTCCGTGGTTAAAAATTGACCACCTTTTGGTTTAAAAAAAAAAAATTAAAAACGCAAGTGAAATTTTTCCAGAAAAACAAAAATTAAACTTCTAAAGAAATTCCTCTGTTATCCCCCCAGTTTAATAAAGCTGCCCCCTTAGTGCGTTTGGTATTCAGAACATAAAATTTGATGTGATTCAGCTCCAACATTATTAAAAAGAAATGGTATTTCCCAAAGAAGTATATCACCTTTGTTTGACTCGCCCACATCTTCCAGAGAAAGTGGCTGGAATTGTATTTTTGCAGCCTTGTGTTGCATTGGAGCCCTAATTTGTCCGCTTCCCTCGAGAAGCCCATCTCCATAATATACACCTACACTGCTTGGTTTTGGGGTTTTATCCGCCCTCTAGAATGTGCTACACTTTCAGCCATTATCAATTACTGTTTGGTGTAGGCAATATGGAAAAAATGCCTTCTACAAAAAAATGGAGACTGGAGACCATAGTTGAACCTTACCCAAAATTGGTATCCATCTTTTCTTCAGCTTTCTCTGCCTTTGGCCTACTCATGGGTAGAGTGAAGTTTACGAACCTAGGGGTGTCTATATGTGTGACCTACTACATTTTCAACAGGTTTAAGGTGGGAAAAAAATGATCTTCTAAGGAATTTTTAGCACCTAGCTTTCCTGTATAATAAGACTAGTTTCCTCAGTGTATTAGACTTATGTTCAGCATTCCCTGTATGAGATTATTTGTTTGTTTTTTTTAATTATTTGTACAAGGACAGACCAGGAAAACATTGAATTTTGACACAAAGTTGTGATACGCAAGTGAAGACTGATCACCACTGTGGCAAGTGCAGATTTCAGCTCAAACACTTAGCTGCGGAATTATAAGG
  3   1   2       bld Ga12                                 XL199d08.3p                                                                                                                                                                                                                                                                                                                                                                                           GTATTCAGAACATAAAATTTGATGTGATTCAGCTCCAACATTATTAAAAAGAAATGGTATTTCCCAAAGAAGTATATCACCTTTGTTTGACTCGCCCACATCTTCCAGAGAAAGTGGCTGGAATTGTATTTTTGCAGCCCTGTGTTGCATTGGAGCCCTAATTTGTCCGCTTCCCTCGAGAAGCCCATCTCCATAATATACACCTACACTGCTTGGTTTTGGGGTTTTATCCGCCCTATAGAATGTGCTACACTTTCAGCCATTATCAATTACTGTTTGGTGTAGGCAATATGGAAAAAATGCCTTCTACAAAAAAATGGAGACTGGAGACCATAGTTGAACCTTACCCAAAATTGGTATCCATCTTTTCTTCAGCTTTCTCTGCCTTTGGCCTACTCATGGGTAGAGTGAAGTTTACGAACCTAGGGGTGTCTATATGTGTGACCTACTACATTTTCAACAGGTTTAAGGTGGGAAAAAAAATGATCTTCTAAGGAATTTTTAGCACCTAGCTTTCCTGTATAATAAGACTAGTTTCCTCAGTGTATTAGACTTATGTTCAGCATTCCCTGTATGAGATTATTTGTTTGTTTTTTTTAATTATTTGTACAAGGACAGACCAGGAAAACATTGAATTTTGACACAAAGTTGTGATACGCAAGTGAAGACTGATCACCACTGTGGCAAGTGCTGATTTCAGCTCAAACACTTAGGGGCAGATT
  5   1   2       bld Egg1                            IMAGE:4784113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGACTCGCCCACATCTTCCAGAGAAAGTGGCTGGAATTGTATTTTTGCAGCCTTGTGTTGCATTGGAGCCCTAATTTGTCCGCTTCCCTCGAGAAGCCCATCTCCATAATATACACCTACACTGCTTGGTTTTGGGGTTTTATCCGCCCTCTAGAATGTGCTACACTTTCAGCCATTATCAATTACTGTTTGGTGTAGGCAGTATGGAAAAAATGCCTTCTACAAAAAAATGGAGACTGGAGACCATAGTTGAACCTTACCCAAAATTGGTATCCATCTTTTCTTCAGCTTTCTCTGCCTTTGGCCTACTCATGGGTAGAGTGAAGTTTACGAACCTAGGGGTGTCTATATGTGACCTACTACATTTTCAACAGGTTTAAGGTGGGAAAAAAATGATCTTCTAAGGAATTTTTAGCACCTAGCTTTCCTGTATAATAAGACTAGTTTCCTCAGTGTATTAGACTTATGTTCAGCATTCCCTGTATGAGATTATTTGTTTGttttttttAATTATTTGTACAAGGACAGACCAGGAAAACATTGAATTTTGACA
  5   1   2      shim Egg2                   IMAGE:5278767-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATATGGAAAAAATGCCTTCTACAAAAAAATGGAGACTGGAGACCATAGTTGAACCTTACCCAAAATTGGTATCCATCTTTTCTTCAGCTTTCTCTGCCTTTGGCCTACTCATGGGTAGAGTGAAGTTTACGAACCTAGGGGTGTCTATATGTGTGACCTACTACATTTTCAACAGGTTTAAGGTGGGAAAAAAATGATCTTCTAAGGAATTTTTAGCACCTAGCTTTCCTGTATAATAAGACTAGTTTCCTCAGTGTATTAGACTTATGTTCAGCATTCCCTGTATGAGATTATTTGTTTGttttttttAATTATTTGTACAAGGACAGACCAGGAAAACATTGAATTTTGACACAAAGTTGTGATACGCAAGTGAAGACTGATCACCACTGTGGCAAGTGCTGATTTCAGCTCAAACACTTAGGGGCAGATTTATTAAGGGTCTGTTAAAACTCCCATGAAATTaaaaaaaaaaaaaaccaaaaaaaaagaaacgaaattttttaaaaaacaaaaCTTTAAATTTTTCTAATTCGTGTGAATGGGATTGATCCGCAAACTCAAATTGGATCGAATTTGATTCGAGTTTTTTCACCaaaaaaaaTATAAATTTTCAGGATGTCTCCAAACAACTCCAATTGATTCCAGGACCTCCCCCATAGGCTAAAAACAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)