Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012787850 Xl3.1-IMAGE:3516807-IMAGp.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3516807-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGCGCTACAAGGAAACATATGGGAGGCCATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGTGCCTTCAGCAGTTCCCCTCTACAACTCTCAGACTGTGATTTGGGAACCATAGGTCTGACCCCTGTGTCTAGCAGCGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAACTCTGGAAAATTTGGCACCTTCCCAGTGTGTGCCTGGCTCAGGAACCAAGCCTATTGCTTTGCTTTAATAGCGGGACATCATTCAATTCAAACCCACTGTGATGACTTCTCTATGTATATTGGCACTGTACTGAAAGAGGTGAACACGAGCAACTGACAGGGTTTAGGATGCCTTATTGATACTGGGAAACAAACAAACTTGCACAATTTACTCTGCCGCCAACTATCTGCAAAATAAGAAGCCTGTTTAACAACACAAAGCATTATTTTTACTGTACGATTATTATTGCCATTGCTGCCTCTAGACCCAGTTTTTCGGTTGGAAAAAAAAGTTAAATATTGCAGTGAAATCAGTGTTGCATATTCAGGGTAAAATCAATATTCCATGGATGAAGACTTTGCATCAAAAAACATTTTCTACTGAAGAAGACAATTATTGCACTGTAAAGACACAACTTCTGTT
                                                  Xl3.1-CHK-1012712648                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTACAAGGAAACATATGGGAGGCCATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGTGCCTTCAGCAGTTCCCCTCTACAACTCTCAGACTGTGATTTGGGAACCATAGGTCTGACCCCTGTGTCTAGCAGCGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAACTCTGGAAAATTTGGCACCTTCCCAGTGTGTGCCTGGCTCAGGAACCAAGCCTATTGCTTTGCTTTAATAGCGGGACATCATTCAATTCAAACCCACTGTGATGACTTCTCTATGTATATTGGCACTGTACTGAAAGAGGTGAACACGAGCAACTGACAGGGTTTAGGATGCCTTATTGATACTGGGAAACAAACAAACTTGCACAATTTACTCTGCCGCCAACTATCTGCAAAATAAGAAGCCTGTTTAACAACACAAAGCATTATTTTTACTGTACGATTATTATTGCCATTGCTGCCTCTAGACCCAGTTTTTCGGTTGGAAAAAAAAGTTAAATATTGCAGTGAAATCAGTGTTGCATATTCAGGGTAAAATCAATATTCCATGGATGAAGACTTTGCATCAAAAAACATTTTCTACTGAAGAAGACAATTATTGCACTGTAAAGACACAACTTCTGTTGTCAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2
                                                                       ...PROTEIN --- Mm ---- 3e-019     NP_683737.2 forkhead box N4 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-020     XP_543440.2 PREDICTED: similar to Forkhead box protein N4 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 5e-021     XP_593659.4 PREDICTED: similar to forkhead box N4 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 5e-021     NP_571174.1 forkhead box N4; winged helix nude [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-022     NP_998761.2 forkhead box N4 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 4e-032     NP_001076828.1 forkhead box N4 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 6e-042     NP_001096332.1 forkhead box N4 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-044     AAI42563.1 Forkhead box protein FoxN4 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3516807-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAG------------------------------ATG---------------------------TGA------TGA---------------------TAG---------------------------------------------------------------------------------TAA---------------------------------------------------TAG------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                ]
  5   1   2      seed Gas8                   IMAGE:3516807-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGCGCTACAAGGAAACATATGGGAGGCCATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGTGCCTTCAGCAGTTCCCCTCTACAACTCTCAGACTGTGATTTGGGAACCATAGGTCTGACCCCTGTGTCTAGCAGCGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAACTCTGGAAAATTTGGCACCTTCCCAGTGTGTGCCTGGCTCAGGAACCAAGCCTATTGCTTTGCTTTAATAGCGGGACATCATTCAATTCAAACCCACTGTGATGACTTCTCTATGTATATTGGCACTGTACTGAAAGAGGTGAACACGAGCAACTGACAGGGTTTAGGATGCCTTATTGATACTGGGAAACAAACAAACTTGCACAATTTACTCTGCCGCCAACTATCTGCAAAATAAGAAGCCTGTTTAACAACACAAAGCATTATTTTTACTGTACGATTATTATTGCCATTGCTGCCTCTAGACCCAGTTTTTCGGTTGGaaaaaaaaGTTAAATATTGCAGTGAAATCAGTGTTGCATATTCAGGGTAAAATCAATATTCCATGGATGAAGACTTTGCATCAAAAAACATTTTCTACTGAAGAAGACAATTATTGCACTGTAAAGACACAACTTCTGTTGTCAAC
  5   1   2       bld Gas8      in                    IMAGE:3516807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGCGCTACAAGGAAACATATGGGAGGCCATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGTGCCTTCAGCAGTTCCCCTCTACAACTCTCAGACTGTGATTTGGGAACCATAGGTCTGACCCCTGTGTCTAGCAGCGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAACTCTGGAAAATTTGGCACCTTCCCAGTGTGTGCCTGGCTCAGGAACCAAGCCTATTGCTTTGCTTTAATAGCGGGACATCATTCAATTCAAACCCACTGTGATGACTNCTCTATGTATATTGGCACTGTACTGAAAGAGGTGAACACGAGCAACTGACAGGGTTTAGGATGCCTTATTGATACTGGGAAACAAACAAACTTGCACAATTTACTCTGCCGCCAACTATCTGCAAAATAAGAAGCCTGTTTAACAACACAAAGCATTATTTTTACTGTACGATTATTATTGCCATTGCTGCCTCTAGACCCAGTTTTTCGGTTGGaaaaaaaaGTTAAATATTGCAGTGAAATCAGTGTTGCATATTCAGGGTAAAATCAATATTCCATGGATGAAGACTTTGCATCAAAAAACATTTTCTACTGAAGA
  3   1   2       bld Gas8      in                    IMAGE:3516807.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAACTCTGGAAAATTTGGCACCTTCNCAGTGTGTGCCTGGCTCAGGAACCAAGCCTATTGCTTTGCTTTAATAGCGGGACATCATTCAATTCAAACCCACTGTGATGACTTCTCTATGTATATTGGCACTGTACTGAAAGAGGTGAACACGAGCAACTGACAGGGTTTAGGATGCCTTATTGATACTGGGAAACAAACAAACTTGCACAATTTACTCTGCCGCCAACTATCTGCAAAATAAGAAGCCTGTTTAACAACACAAAGCATTATTTTTACTGTACGATTATTATTGCCATTGCTGCCTCTAGACCCAGTTTTTCGGTTGGAAAAAAAAGTTAAATATTGCAGTGAAATCAGTGTTGCATATTCAGGGTAAAATCAATATTCCATGGATGAAGACTTTGCATCAAAAAACATTTTCTACTGAAGAAGACAATTATTGCACTGTAAAGACACAACTTCTGTTGTCAACAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)