Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:3747102.3                       6 END     1          20       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6642407.5                      13 PI      88          4      577                (no blast hit)

 This cluster: approximate FL confidence score = 64%

 1012787893 Xl3.1-IMAGE:5079033.5 - 5 ESTs
                                                                       .-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5079033.5                      TTGATTTCACCTATGCCAAGATGCATCGAGAAATAGAGGCAGCAGTCACCTTCCTTGTGAAGATTCTGAGCTTAAAGTGGTGTGTGAAGCCTGAGAAACTGGTGGTTTTGGCAGAGAACATGGCACGTCTCTTGAATAAGAAATACCAAGGCCACTGGTACCCAGACAAACCTGACCGGGGACAGGCTTACAGATGTATCCGCATCAATCCCTGGCAGTATGTGGATGAGTCCTTGCTTCTGGCCTGTGCGATGAGTGGCCTAGACTACTCAAGACTTCTTCTATGGGACGAGATGGCCATTTGGATTGACCCTTTTGAAGTCTGTGGCAGGTTTGGGGAGAACACTGACTTCTTCACAATAGCATCCTTCCAAAATGAGGTGGCAGTCAAAGAATACAAGAGGAAGCATTCAGAGCAGACTTCTGATTATTCCTCAGATGGACCTTCCTCTGGGACTGTTTCTGAGAACTCATCTGATGACGAGACAGCTGGGGAGAAGGCTACACCCTCAAAGAACATGAGTAGTGTCCTCATAGTGGATGACTGTATTGCTATACCTAGCAATGGACCTCTCATCCCAAACACAGGGTCTCTGGTGAATGTTGTATGAATGTCATCCAAAGACATGGGCCCAA
                                                  Xl3.1-CHK-1012703327                            TCACCTATGCCAAGATGCATCGAGAAATAGAGGCAGCAGTCACCTTCCTTGTGAAGATTCTGAGCTTAAAGTGGTGTGTGAAGCCTGAGAAACTGGTGGTTTTGGCAGAGAACATGGCACGTCTCTTGAATAAGAAATACCAAGGCCACTGGTACCCAGACAAACCTGACCGGGGACAGGCTTACAGATGTATCCGCATCAATCCCTGGCAGTATGTGGATGAGTCCTTGCTTCTGGCCTGTGCGATGAGTGGCCTAGACTACTCAAGACTTCTTCTATGGGACGAGATGGCCATTTGGATTGACCCTTTTGAAGTCTGTGGCAGGTTTGGGGAGAACACTGACTTCTTCACAATAGCATCCTTCCAAAATGAGGTGGCAGTCAAAGAATACAAGAGGAAGCATTCAGAGCAGACTTCTGATTATTCCTCAGATGGACCTTCCTCTGGGACTGTTTCTGAGAACTCATCTGATGACGAGACAGCTGGGGAGAAGGCTACACCCTCAAAGAACATGAGTAGTGTCCTCATAGCGGATGACTGTATTGCTATACCTAGCAATGGACCTCTCATCCCAAACACAGGGTCTCTGGTGAATGTTGTATGAATGTCATCCAAAGACATGG
                                                      consensus depths                           3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     2     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3
                                               BLH ATG      20     117                      
                                               BLH MPR      -4      46                      
                                                                                                                PROTEIN === ?? ==== 2e-012     NP_001007376.2 B-cell translocation gene 1-like [Danio rerio] =======================================================================================================================================================================================================================================
                                                                                                                PROTEIN === Dm ==== 1e-013     NP_996483.1 CG9214-PB, isoform B [Drosophila melanogaster] =======================================================================================================================================================================================================================================
                                                                                                                PREDICTED = Sp ==== 1e-019     XP_001176107.1 PREDICTED: similar to BTG family, member 3 [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PROTEIN === Dr ==== 5e-027     NP_001007352.1 zgc:103463 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PREDICTED = Gg ==== 5e-027     XP_417919.1 PREDICTED: similar to p30 B9.10 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PROTEIN === Hs ==== 3e-028     NP_006797.3 B-cell translocation gene 3; abundant in neuroepithelium area [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PREDICTED = Bt ==== 1e-028     NP_001029894.1 hypothetical protein LOC541054 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PREDICTED = Cf ==== 2e-029     XP_544819.2 PREDICTED: similar to BTG3 protein (Tob5 protein) (Abundant in neuroepithelium area protein) isoform 2 [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================
                                                                                                                PREDICTED = Mm ==== 3e-030     XP_001480527.1 PREDICTED: similar to BTG3 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PROTEIN === Xt ==== 8e-090     NP_001037965.1 novel protein similar to BTG family, member 3 btg3 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                        PROTEIN === Xl ==== 2e-116     AAI10923.1 LOC733441 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5079033.5                                          ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TGAATG------------ATG
                                                                   ORF                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Oo1  5x3                        IMAGE:5079033.5p TTCTGTAGAGTGTTTCCTTTGTTGATTTCACCTATGCCAAGATGCATCGAGAAATAGAGGCAGCAGTCACCTTCCTTGTGAAGATTCTGAGCTTAAAGTGGTGTGTGAAGCCTGAGAAACTGGTGGTTTTGGCAGAGAACTTGGCACGTCTCTTGAATAAGAAATACCAAGGCCACTGGTACCCAGACAAACCTGACCGGGGACAGGCTTACAGATGTATCCGCATCAATCCCTGGCAGTATGTGGATGAGTCCTTGCTTCTGGCCTGTGCGATGAGTGGCCTAGACTACTCAAGACTTCTTCTATGGGACGAGATGGCCATTTGGATTGACCCTTTTGAAGTCTGTGGCAGGTTTGGGGAGAACACTGACTTCTTCACAATAGCATCCTTCCAAAATGAGGTGGCAGTCAAAGAATACAAGAGGAAGCATTCAGAGCAGACTTCTGATTATTCCTCAGATGGACCTTCCTCTGGGACTGTTTCTGAGAACTCATCTGATGACGAGACAGCTGGGGAGAAGGCTACACCCTCAAAGAACATGAGTAGTGTCCTCATAGCGGATGACTGTATTGCTATACCTAGCAATGGACCTCTCATCCCAAACACAGGGTCTCTGGTGAATGTTGTATGAATGTCATCCAAGGACATGGGCCAAGATGCCTGGATTGTAGATGCCTCCTACTTAGACTGTATACAAGACAAATGGCTCAGAAGACTGCCAGTACTAGAACCAAATGGCACACACAGTGGTGGAATCTCGTNCTTTCTTATAATGGTGATACAGTGCCCACTGTTATCTAGGGGCTTCTCTCAGCTGTGCAACTGATTTGACCTAAATGGCACTAGAACAAtttttaaattttatttttaacttttttttttttATCCTCCTACCCCCTATGCCCAGCCTTTCCTTAGGA
  5   1   2       add Oo1  5x3                        IMAGE:6642597.5p          CTCGATCCTTTGTTGATTTCACCTATGCCATGATGCATCAAGAAATAGAGGCAGCAGTCACCTTCCTTGTGAAGATTCTGAGCTTAAAGAGGTGTGTGAAGCCTGAAAAACTGGTGGTTTTGGCAGAGAACATGGCACGTCTCTTGAATAAGAAATACCAAGGCCACTGGTACCCAGACAAACCTGACCAGGGACAGGCTTACAGATGTATCTGCATCAATCCCTGGCAGTATGTGGATGAGTCCTTGCTTCTGGCCTGTGCGATGAGTGGCCTAGACTACTCAAGACTTCCTCTACGGGATGAGATGACCATTTGGATTGACCCTTTTGAAGTCTGTGGCAGGTTTGGGGAGCACACTGACTTCTTCACAATAGCATCCTTCAAAAATGAGGTGGCAGTCAAAGAATACAAGAGGAAGCATTCAGAGCAGACTTCCGATTATTCCTCAGATGGACCTTCCTCTGCGACTGTTTCTGAGAACTCATCTGATGACGAGACAGCTGGGGAGAAGGCTACACCCTCAAAGAACATGAGTAGTGTCCTCATAGTGGATGACTGTATTGCTATACCTAGCAATGGACCTCTCATCCCAAACACAGGGTCTCTGGTGAATGTTGTATGAATGTCATCCAAAGACATGGGCCCAAGATGCCTGGATTGTAAATGCCTCCTACTTAGACTGTATACAAGACAATGGCCTCAGAAGACTGCCAGTACTAGAACCAAAATGGCACACAGTGGTGGAATCTCCTCTTTCTTATAATGGTGATACAGTGACACTGTTATCTAGGGGCTTTTCTCGGCTGTGCCACTGATTGCCCTAATAACCCTAGAACAattttaaattttattttaactttattttttttaTCCNCCTTACCCCCTATGCAAAGGTTTTCCTTAGGATTGGGGTTCCCCCTTAA
  5   1   2      seed Oo1  5g3  out                   IMAGE:3404743.5p                      TTGATTTCACCTATGCCAAGATGCATCGAGAAATAGAGGCAGCAGTCACCTTCCTTGTGAAGATTCTGAGCTTAAAGTGGTGTGTGAAGCCTGAGAAACTGGTGGTTTTGGCAGAGAACATGGCACGTCTCTTGAATAAGAAATACCAAGGCCACTGGTACCCAGACAAACCTGACCGGGGACAGGCTTACAGATGTATCCGCATCAATCCCTGGCAGTATGTGGATGAGTCCTTGCTTCTGGCCTGTGCGATGAGTGGCCTAGACTACTCAAGACTTCCTCTATGGGACGAGATGACCATTTGGATTGACCCTTTTGAAGTCTGTGGCAGGTTTGGGGAGAACACTGACTTCTTCACAATAGCATCCTTCCAAAATGAGGTGGCAGTCAAAGAATACAAGAGGAAGCATTCAGAGCAGACTTCTGATTATTCCTCAGATGGACCTTCCTCTGGGACTGTTTCTGAGAACTCATCTGATGACGAGACAGCTGGGGAGAAGGCTACACCCTCA
  5   1   2       bld Oo1  5g                         IMAGE:3404342.5p                                       AAGATGCATCGAGAAATAGAGGCAGCAGTCACCTTCCTTGTGAAGATTCTGAGCTTAAAGTGGTGTGTGAAGCCTGAGAAACTGGTGGTTTTGGCAGAGAACATGGCACGTCTCTTGAATAAGAAATACCAAGGCCACTGGTACCCAGACAAACCTGACCGGGGACAGGCTTACAGATGTATCCGCATCAATCCCTGGCAGTATGTGGATGAGTCCTTGCTTCTGGCCTGTGCGATGAGTGGCCTAGACTACTCAAGACTTCTTCTATGGGACGAGATGGCCATTTGGATTGACCCTTTTGAAGTCTGTGGCATGTTTGGGGAGAACACTGACTTCTTCACAATAGCATCCTTCCAAAATGAGGTGGCAGTCAAAGAATACAAGAGGAAGCATTCAGAGCAGACTTCTGATTATACCTCAGATGGACCTTCCTCTGGGACTGTTTCTGAGAACTCATCTGATGACGAGACAGCTGGGGAGAAAGCTACACCCTCA
  5   1   2       bld Ooc3                            IMAGE:3472849.5p                                                                                                                                                                                                                                                                                                                                                                                                           AAATGAGGTGGCAGTCAAAGAATACAAGAGGAAGCATTCAGAGCAGACTTCCGATTATTCCTCAGATGGACCTTCCTCTGGGACTGTTTCTGAGAACTCATCTGATGACGAGACAGCTGGGGAGAAGGCTACACCCTCAAAGAACATGACTAGCGCCCTCATAGCGGATGACTGTATTGCTATACCTAGAAATGGACCTCTCATCCCAAACACGGGGTTTCTTTTTTTTTCCCCCCCCCAggggggggggggggggggcccccccatcccccaactcaaacccccccctccccgacgccgacccgccccggcggcccccaccactccccccccacaacccaagcgacccggccgcggccccccgccgccccacgcgggcgatcgcccgccgcggcccgccccccccccGCGGACACCCCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)