Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012787905 Xl3.1-IMAGE:5542637-IMAGp.5 - 3 ESTs
                                                                       ...-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:5542637-IMAGp.5                                                                                                        ACAGCAGCTCAGCGGAGCACTGCGGAGCTTCCAAGCCGCCTCTAAGCTCCTCCAGTATGACATCACGGATTTTGCTACGACAGCAACTGATGCGTGAGCAGATGCAACAGCAAGAGCGACGAGAGCAGCAACAGAAGCAGCAGGCAGCTCAGTTCATGCAACAGAGAGCGGCCGTCAGCCACACGCCAGCCATTAACGTCTCCAGCAGCCTGCCTGCCTCCTCCCAGGTACCAATGGAAGTACTCAAGGTGCAGACCCACCTTGAAAATCCTACCAAGTACCACATCCAACAAGCTCAGAAACAGCAGGTAAAGCAATACCTGACTACGGCCAAACACTCCGGCCAGGCGTTAAGCTTACCCTGTCCAAACCAGCCTGGTGATCACATCATGCCCCCTGGACCGGGAAGCAGCGCGCCAAACAGTCCAATGGCTTTGTTAACAATTGGTTCAACCTGTGAAAAAGAGATGGATGATGTGATTGATGATATAATAAGCTTGGAGTCCAGTTATAATGAAGACATTCTCTTAATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATTTGATTGACATTTATGGAAATCAAGGTATGCCTCCTCCGGGGTTAAACATCAGTAATTCTTGCCCTGCTAATCTGCCCAATATCAAAAGGGAGTTCACAGGAACTGTTATGTTACGGTCAGTAGATCGGAAATGGAGAGGGCCCTAAAGAGCTTGCCAGTGGCCCTCGTAGAATTGGAACATCAACGATCAAATCGGGAGGCACGAGCAATGGGCCAAGGAAACGGGCAAAAAGAAGGTGAGGTGGAAACTTCATTGAAAAGAAAGGGCGAAGAATTTAAACCATC
                                                  Xl3.1-CHK-1012711912                                                                                                              GCTCAGCGGAGCACTGCGGAGCTTCCAAGCCGCCTCTAAGCTCCTCCAGTATGACATCACGGATTTTGCTACGACAGCAACTGATGCGTGAGCAGATGCAACAGCAAGAGCGACGAGAGCAGCAACAGAAGCAGCAGGCAGCTCAGTTCATGCAACAGAGAGCGGCCGTCAGCCACACGCCAGCCATTAACGTCTCCAGCAGCCTGCCTGCCTCCTCCCAGGTACCAATGGAAGTACTCAAGGTGCAGACCCACCTTGAAAATCCTACCAAGTACCACATCCAACAAGCTCAGAAACAGCAGGTAAAGCAATACCTGACTACGGCCAAACACTCCGGCCAGGCGTTAAGCTTACCCTGTCCAAACCAGCCTGGTGATCACATCATGCCCCCTGGACCGGGAAGCAGCGCGCCAAACAGTCCAATGGCTTTGTTAACAATTGGTTCAACCTGTGAAAAAGAGATGGATGATGTGATTGATGATATAATAAGCTTGGAGTCCAGTTATAATGAAGACATTCTCTTAATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATTTGATTGACATTTATGGAAATCAAGGTATGCCTCCTCCGGGGTTAAACATCAGTAATTCTTGCCCTGCTAATCTGCCCAATATCAAAAGGGAGTTCACAGGAACTGTTATGTTACGGTCAGTAGATCGGAAATGGAGAGGGCCCTAAAGAGCTTGCCAGTGGCCCTCGTAGAxxTxxAACATCAxxxAxxAAATCGGGAGGCACGAGCAATGGGCCAAGGAAACGGGCAAAAxxxAxxTGAGGTxxxAxCTTCATTGAAAAGAAAGGGCGAAGAATTTAA
                                                      consensus depths                                                                                                             1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1
                                                                       PROTEIN --- Ag ---- 4e-009     XP_001689401.1 AGAP000807-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Cf ---- 1e-064     NP_001003337.1 microphthalmia-associated transcription factor [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 9e-065     NP_000239.1 microphthalmia-associated transcription factor isoform 4 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dr ---- 3e-079     NP_571922.1 microphthalmia-associated transcription factor b [Danio rerio] -----===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PROTEIN --- Mm ---- 4e-101     NP_001106669.1 microphthalmia-associated transcription factor isoform 1 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN === Xl ==== 1e-135     AAI66049.1 Unknown (protein for IMAGE:5542637) [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:5542637-IMAGp.5                                                                                                                                                                ATG------------------------------ATG---------ATG---------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------ATG------------------------------------------------------------ATG---------ATG---ATG------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------TAA---------------------TAG------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2       bld Emb4                   IMAGE:5542637-IMAGp.IMAGp                                                                                                        ACAGCAGCTCAGCGGAGCACTGCGGAGCTTCCAAGCCGCCTCTAAGCTCCTCCAGTATGACATCACGGATTTTGCTACGACAGCAACTGATGCGTGagcagatgcaacagcaagagcgacgagagcagcaacagaagcagcaggcagcTCAGTTCATGCAACAGAGAGCGGCCGTCAGCCACACGCCAGCCATTAACGTCTCCAGCAGCCTGCCTGCCTCCTCCCAGGTACCAATGGAAGTACTCAAGGTGCAGACCCACCTTGAAAATCCTACCAAGTACCACATCCAACAAGCTCAGAAACAGCAGGTAAAGCAATACCTGACTACGGCCAAACACTCCGGCCAGGCGTTAAGCTTACCCTGTCCAAACCAGCCTGGTGATCACATCATGCCCCCTGGACCGGGAAGCAGCGCGCCAAACAGTCCAATGGCTTTGTTAACAATTGGTTCAACCTGTGAAAAAGAGATGGATGATGTGATTGATGATATAATAAGCTTGGAGTCCAGTTATAATGAAGACATTCTCTTAATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATTTGATTGACATTTATGGAAATCAAGGTATGCCTCCTCCGGGGTTAAACATCAGTAATTCTTGCCCTGCTAATCTGCCCAATATCAAAAGGGAGTTCACAGGAACTGTTAT
  5   1   2      seed Emb4                            IMAGE:5542637.5p                                                                                                         CAGCAGCTCAGCGGAGCACTGCGGAGCTTCCAAGCCGCCTCTAAGCTCCTCCAGTATGACATCACGGATTTTGCTACGACAGCAACTGATGCGTGAgcagatgcaacagcaagagcgacgagagcagcaacagaagcagcaggcagcTCAGTTCATGCAACAGAGAGCGGCCGTCAGCCACACGCCAGCCATTAACGTCTCCAGCAGCCTGCCTGCCTCCTCCCAGGTACCAATGGAAGTACTCAAGGTGCAGACCCACCTTGAAAATCCTACCAAGTACCACATCCAACAAGCTCAGAAACAGCAGGTAAAGCAATACCTGACTACGGCCAAACACTCCGGCCAGGCGTTAAGCTTACCCTGTCCAAACCAGCCTGGTGATCACATCATGCCCCCTGGACCGGGAAGCAGCGCGCCAAACAGTCCAATGGCTTTGTTAACAATTGGTTCAACCTGTGAAAAAGAGATGGATGATGTGATTGATGATATAATAAGCTTGGAGTCCAGTTATAATGAAGACATTCTCTTAATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATTTGATTGACATTTATGGAAATCAAGGTATGCCTCCTCCGGGGTTAAACATCAGTAATTCTTGCCCTGCTAATCTGCCCAATATCAAAAGGGAGTTCACAGGAACTGTTATGTTACGGTCAGTAGATCGGAAATGGAGAGGGCCCTAAAGAGCTTGCCAGTGGCCCTCGTAGAATTGGACNACAGTTAAAAAAATCGGGAGGCACGAGCAATGGGCCAAGGAAACGGGCAAAAAGAAGGACNNATCACACCTTCATTGAAAAGAAAGGGCGAAGAATTTAAACCATCA
  5   1   2       bld Kid                             IMAGE:7010245.5p                                                                                                                                                                                                                      CAAGAGCGACGAGAGCAGCAACAGAAGCAGCAGACAGCTCAGTTCATGCAACAGAGAGCGGCCGTCAGCCACACGCCAGCCATTAACGTCTCCAGCAGCCTGCCTGCTTCCCCCCAGGTACCAATGGAAATACTCAAGGTGCAGACCCACCTTGAAAATCCAACCAAGTACCACATCCAACAAGCCCAAAAACAGCAGGTAAAGCAATACCTGACTACGGCCAAACACTCCGGCCAGGCGTTAAGCTTACCCTGTCCAAATCAGCCTGGTGATCACATCATGCCCCCTGGACCGGGAAGCAGCGCGCCAAACAGTCCAATGGCTTTGTTAACAATTGGTTCAACCTGTGAAAAAGAGATGGATGATGTGATCGATGATATAATAAGCTTGGAGTCCAGTTATAATGAAGATATTCTCTTGATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATTTGATTGACATTTATGGAAATCAAGGTATGCCTCCACTGGGGTTAAACATCACTAATTCTTGCCCTGCTAATCTGCCCAATATCAAAAGAGAGCTCACAGAAACAGAGGCAAGAGCACTAGCCAAGGAAAGGCAAAAGAAGGACAATCACAACCTCATTGAAAGAAGGCGAAGATTTAACATCAACGATCGCATTANAGAATTAGGAAACTTTATACCCAAATCNAATGATCCTGACATGAGGTGGAAACAGGGAAAACATATAAAGCTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)