Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012787972 Xl3.1-IMAGE:5572665.5 - 8 ESTs
                                                                       ......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5572665.5                                                                                       CAAGGCTAGTGTGAGGGCTGTGTTGGTGCTCCTTGCTTGCTGCCTTCAGGAGGTTCGCGCTCAATTCCCCAGGCCGTGCGTGACGGTGGAGGCGTTAACGTCTAAGCGCTGCTGCCCTGCTCTGGGCTCCGATCCCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGCTGTAGATGAGCGACCCTGGAGCGGACCCTATAACTTGCGCAACGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCGACCTGCAGGTGCACAGGCAACTTTGCAGGATTTCATTGCGGGGAATGCAAATTTGGCTGGACTGGACCCAGTTGTGAGCAGAGGAAGCCTCCTGTTGTGCGAAAAAATATTCATTCATTGACTGCGCAGGAGAGAGCCCAGTTCTTGGATGCGCTGGATCAGGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATGCTAGCATCTACAACTACTTTGTGTGGCTCCATTACTACTCTGTCCGGGACACATTGCTCGGGCCCGGGACGTCCCTTCACTGCAAATTGACTTCCTCCCCACCAGGGACCAGCTTTTTGGTACTTGGGCATCCGTTACCCCCCTGTTTACTGCTGGAAAAGGGGATCTTCACAAAATGATTGTCCTTTGCTTTGCCGTACTGGAATTTTGCAACGGGGAAATTTTGCAACCGGGAAAGGAAATTAAGCGTGCAAGCTTTCGTACTGGAACCAAGCTATTTTGGGGGGTACCTCACAACCTGGGATGCACCCCGGGGAATCGTGTGCAACAGTTTGAATGACTACAATCGGCTGGTGACCCTGTGTAATGGAACTAATGAAGGGTTCCTTCAGAGAAACCCTTTGGGTGGTGGAGGAGGAAGACTTCCATCCGTGGAAGATGTACAGAAATGTCTCTCGCTGAACGAGTTTGATAATCCTCCTTTTTTCAGGAATTCCACTTTCAGCTTTCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAACTCAACAGCAATGAGTCTTCACAACCTCGTCCATTCTTTCTTAAATGGAACAAGTGCGCAATCACACTCTGCCGCCAATGACCC
                                                  Xl3.1-CHK-1012698224                                                                                             TAGTGTGAGGGCTGTGTTGGTGCTCCTTGCTTGCTGCCTTCAGGAGGTTCGCGCTCAATTCCCCAGGCCGTGCGTGACGGTGGAGGCGTTAACGTCTAAGCGCTGCTGCCCTGCTCTGGGCTCCGATCCCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGCTGTAGATGAGCGACCCTGGAGCGGACCCTATAACTTGCGCAACGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCGACCTGCAGGTGCACAGGCAACTTTGCAGGATTTCATTGCGGGGAATGCAAATTTGGCTGGACTGGACCCAGTTGTGAGCAGAGGAAGCCTCCTGTTGTGCGAAAAAATATTCATTCATTGACTGCGCAGGAGAGAGCCCAGTTCTTGGATGCGCTGGATCAGGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATGCTAGCATCTACAACTACTTTGTGTGGCTCCATTACTACTCTGTCCGGGACACATTGCTCGGGCCGGGGACGTCCCTTCACTGCAAxTxxxxTTCCTCCCCACCAGGGACCAGCTTTTTGGTACTTGGGCATCCGTTACCCCCCTGTTTACTGCTGGAAAAGGGGATCTTCACAAAATGATTxxxCxxTGCTTTGCCGTACTGGAATTTTGCAACGGGxAAAxxTTGCAACCGGGAAAGGAAATTAAGCGTGCAAGCTTTCGTACTGGAACCAAGCTATTTTGGGGGGTACCTCACAACCTGGGATGCACCCCGxxxxxxCGTGTGCAACAGTTTGAATGACTACAATCGGCTGGTGACCCTGTGTAATGGAACTAATGAAGGGTTCCTTCAGAGAAACCCTTTGGGTGGTGGAGGAGGAAGACTTCCATCCGTGGAAGATGTACAGAAATGTCTCTCGCTGAACGAGTTTGATAATCCTCCTTTTTTCAGGAATTCCACTTTCAGCTTTCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAACTCAACAGCAATGAGTCTTCACAACCTCGTCCATTCTTTCTTAAATGGAACAAGTGCGCAATCACACTCTGCCGCCAATGACCCCATTTT
                                                      consensus depths                                                                                            2     2     3     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     2     4     2     4     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     2     4     2     4     2     4     1     4     1     4     1     4     1     4     1     3     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       PREDICTED - Cf ---- 1e-127     XP_542639.2 PREDICTED: similar to Dopachrome tautomerase precursor (DT) (DCT) (Dopachrome delta-isomerase) (Tyrosinase-related protein 2) (TRP-2) (TRP2) (SLATY locus protein) [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Dr ==== 5e-129     NP_571630.1 dopachrome tautomerase [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Mm ---- 7e-132     NP_034154.2 dopachrome tautomerase [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Hs ---- 7e-132     NP_001123361.1 dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) isoform 2 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Bt ---- 5e-133     NP_001012684.1 dopachrome tautomerase [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Gg ---- 3e-137     NP_990266.1 tyrosinase-related protein-2 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Xt ==== 2e-177     CAJ83137.1 dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN === Xl ==== 0          AAI06679.1 Unknown (protein for IMAGE:4031600) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5572665.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA---------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2       bld Kid                             IMAGE:4031600.5p                                                                                      ACAAGGCTAGTGTGAGGGCTGTGTTGGTGCTCCTTGCTTGCTGCCTTCAGGAGGTTCGCGCTCAATTCCCCAGGCCGTGCGTGACGGTGGAGGCGTTAACGTCTAAGCGCTGCTGCCCTGCTCTGGGCTCCGATCCCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGCTGTAGATGAGCGACCCTGGAGCGGACCCTATAACTTGCGTAACGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCGACCTGCAGGTGCACAGGCAACTTTGCAGGATTTCATTGCGGGGAATGCAAATTTGGCTGGACTGGACCCAGTTGTGAGCAGAGGAAGCCTCCTGTTGTGCGAAAAAATATTCATTCATTGACTGCGCAGGAGAGAGCCCAGTTCTTGGATGCGCTGGATCAGGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATGCTAGCATCTACAACTACTTTGTGTGGCTCCATTACTACTCTGTCCGGGACACATTGCTCGGGCCCGGGACGTCCCCTTCACTGCAATTGACTTCCTCCCCACCAGGGACCAGCTTTTTGGTACTTGGGCATCCGTTACCCCCCTGTTTACTGCTGGAAAAGGGGATCTTCACAAAATGATTTGGCAATGGAGCCCCTTTTGCCTTTGCCCCCAATGGGAAATTTTGCAACCGGGAAAGGAAATTAAGCGTGCAAGCTTTCGTACTGGAACCAAGCTATTTTGGGGGGTACCTCACAACCTGGGATGCACCCCGAATCTGCGATAAACGGGTTGGAATCCCCAGGATTCTCCCCCgggggggggAAACCGCCGTGGCAAACAAGTTTGGAATGGACTAACAATCCGCGCTGGGGGAAACCCCTGGGTTAAAGGGAACCCAAAG
  5   1   2       bld Emb4                            IMAGE:5514682.5p                                                                                       CAAGGCTAGTGTGAGGGCTGTGTTGGTGCTCCTTGCTTGCTGCCTTCAGGAGGTTCGCGCTCAATTCCCTAGGCCGTGCGTGACGGTGGAGGCGTTAACGTCTAAGCGCTGCTGCCCTGCTCTGGGCTCCGATCCCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGCTGTAGATGAGCGACCCTGGAGCGGACCCTATAACTTGCGCAACGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCGACCTGCAGGTGCACAGGCAACTTTGCAGGATTTCATTGCGGGGAATGCAAATTTGGCTGGACTGGACCCAGTTGTGAGCAGAGGAAGCCTCCTGTTGTGCGAAAAAATATTCATTCATTGACTGCGCAGGAGAGAGCCCAGTTCTTGGATGCGCTGGATCAGGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATGCTAGCATCTACAACTACTTTGTGTGGCTCCATTACTACTCTGTCCGGGACACATTGCTCGGGCCGGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCTTTTGTTACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGGGATCTTCAGAANATGATTNGGCATGAGTCCTTTGCTTNNGCGTACTGNAATTNTGCACGGGAANGAATGAGTGTGATGTTGTACTGACNAGTTATTGGGCACCAGACTGGATGACGATCT
  5   1   2       bld Emb4                            IMAGE:5572665.5p                                                                                        AAGGCTAGTGTGAGGGCTGTGTTGGTGCTCCTTGCTTGCTGCCTTCAGGCGGTTCGCGCTCAATTCCCCAGGCCGTGCGTGACGGTGGAGGCGTTAACGTCTAAGCGCTGCTGCCCTGCTCTGGGCTCCGATCCCAACAACGTGTGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGCTGTAGATGAGCGACCCTGGAGCGGACCCTATAACTTGCGCAACTTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCGACCTGCAGATGCACAGGCAACTTTGCAGGATTTCATTGCGGGGAATGCAAATTTGGCTGGACTGGACCCAGTTGTGAGCAGAGGAAGCCTCCTGTTGTGCGAAAAAATATTCATTCATTGACTGCGCAGGAGAGAGCCCAGTTCTTGGATGCGCTGGATCAGGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATGCTAGCATCTACAACTACTTTGTGTGGCTCCATTACTACTCTGTCCGGGACACATTGCTCGGGGCCGGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCCAGCTTTTGTTACTTGGCATCGTTACCACCTGTTACTGCTGGAAAAGGGATCTTCAGAAAATGATTGGCAATGAGTCCTTTGCTTTGCCGTACTGGAATTTTGCAACGGGAAAAGAATGAATTGTGATGTTTTGTACTGACGAAGNTTATTTGGGGGCACCCCAGACTGGGATGACCCGAAATCTGAATAAGTGGCTGGGATCCA
  5   1   2      seed Tbd7      in                         XL082d17.5p                                                                                                           GTGTTGGTGCTCTTTGCTTGCTGCCTTCAGCGGTTCGCGCTCAATTCCCCAGGCCGTGCGTGACGGTGGAGGCGTTAACGTCTAAGCGCTGCTGCCCTGCTCTGGGCTCCGATCCCAACAACGTGTGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGCTGTAGATGAGCGACCCTGGAGCGGACCCTATAACTTGCGCAACGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCGACCTGCAGATGCACAGGCAACTTTGCAGGATTTCATTGCGGGGAATGCAAATTTGGCTGGACTGGACCCAGTTGTGAGCAGAGGAAGCCTCCTGTTGTGCGAAAAAATATTCATTCATTGACTGCGCAGGAGAGAGCCCAGTTCTTGGATGCGCTGGATCAGGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATGCTAGCATCTACAACTACTTTGTGTGGCTCCATTACTACTCTGTCCGGGACACATTGCTCGGGCCGGGGACGTCCCTTCACTGCAATTGACTTCTC
  5   1   2       bld Tbd7      in                         XL070n08.5p                                                                                                                                                                                                                                                                                                                                                                                                         TGCGGGGAATGCAAATTTGGCTGGACTGGACCCAGTTGTGAGCATGAGGAAGCCTCCTGTTGTGCGAAAAAATATTCATTCATTGACTGCGCAGGAGAGAGCCCAGTTCTTGGATGCGCTGGATCAGGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATGCTAGCATCTACAACTACTTTGTGTGGCTNCATTACTACTCT
  5   1   1       add Tad1                            IMAGE:6878296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAGTCCTTTGCTTTGCCGTACTGGAATTTTGCAACGGGAAGGAATGAGTGTGATGTTTGTACTGACGAGTTATTTGGGGCACCCAGACTGGATGACCCGAATCTGATAAGTGCTGGATCCAGGTTCTCGCGGTGGGGAATCGTGTGCAACAGTTTGAATGACTACAATCGGCTGGTGACCCTGTGTAATGGAACTAATGAAGGGTTCCTTCAGAGAAACCCTTTGGGTGGTGGAGGAGGAAGACTTCCATCCGTGGAAGATGTACAGAAATGTCTCTCGCTGAACGAGTTTGATAATCCTCCTTTTTTCAGGAATTCCACTTTCAGCTTTCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAACTCAACAGCAATGAGTCTTCACAACCTCGTCCATTCTTTCTTAAATGGAACAAGTGCGCAATCACACTCTGCCGCCAATGACCCCATTTTTTGTGGTGCTGCACTCTTTTACTGATGCTGTCTTTGATGAATGGATGAGACCCTTTTCGCCATCATATGTTGCCTGGCCTCAAGAATTGGCTCCAATAGGGGCATAAATCGTATGTACAACATGGGTGCCATTTCTTTTCCTCCGGTTACCAAATGAAAAGCTTTTTCCTTGCCAGCCTGAAACAATTTAGGGCCTTGTTTTATTTCTTATCCGACCTATCCAGCCTTTCCCCTTGGAAAAACAACACCTTGCCAATGGGNCTGGTCCCTGGGTTTGGGCTCCCCCCTGGGTTGTGGGGGGCAATTTCCTTCTTTTGGCCCTGGGGCAAACAAACCCTTTTGGCTCCCCTTCCCAAAGGGGCCTTTTTTCACATGC
  3   1   0       add Tbd7      in                         XL082d17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGACTTCCATCCGTGGAAGATGTACAGAAATGTCTCTCGCTGAACGAGTTTGATAATCCTCCTTTTTTCAGGAATTCCACTTTCAGCTTTCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAACTCAACAGCAATGAGTCTTCACAACCTCGTCCATTCTTTCTTAAATGGAACAAGTGCGCAATCACACTCTGCCGCCAATGACCCCATTTTTGTGGTGCTGCACTCTTTTACTGATGCTGTCTTTGATGAATGGATGAGACGCTTTCAGCCATCAGATGTTGCCTGGCCTCAAGAATTGGCTCCAATAGGGCATAATCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCTTGCCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCCTTGAAGACACACGTGCAGTGGCTGTCCTGGTTGGCTCCACTGTTGGTGGCATTCTTCTTGCCTTGCTACTACTCTTGCTCCTCCTAGTGCTTTTCATGCAAAGAAAACGCCAACAAGGCTTTGAGCCCTTGATGAATGCTACCTTTACCAACAAAAGATACACAGAGGATGCATAACATTAAATTGTAACAATATAAACCAGATCTCCGTG
  3   1   0       add Tbd7      in                         XL070n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTNATGCTGTCTTTGATGAATGAGATNAGACGCTTTCAGCCATCAGATGTTGCCTGGCCTCAAGAATTGGCTCCAATAGGGCATAATCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCTTGCCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCCTTNNANACACACGTGCAGTGGCTGTCCTGGTTGGCTCCACTGTTGGTGGCATTCTTCTTGCCTTGCTACTACTCTTGCTCCTCCTAGTGCTTTTCATGCAAAGAAAACGCCNACAAGGCTTTGAGCCCTTGATGAATGCTACCTTNACCAACAAAAGATACACAGAGNATGCATAACATTAAATTGTAACAATATAANCCAGTATCTCCGTGTGTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)