Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 20%

 1012788238 Xl3.1-IMAGE:8074547.3 - 7 ESTs
                                                                       ..-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8074547.3                                                                                                                                                                                                                                                                                                                                                                                               AGATGTCCATGGAGAACACTGACACCACTGATAAGCCTCCTCCGTACATGGTGGAGCCACCTTCTAACTCCGTCAACCAAGGATTTGACCCATCTAGGGCAGGGGTGATGGGGATTCCCAATGTCCCAGCTCCACAAGTCCATACCACAGTGGTGAACATCATTCCCGATGGATTTCTCATACGAGACCACTTGCCATGGTCCATTTTTAACACCATGTACATGAACTTCTGCTGCCTGGGGTTCTTTGCAGTTATTTTCTCTGTAAAGTCCCGGGATCAGAAGGTGATTGGAGACAGGTCTGGAGCCATGAGTTATGCTTCTACTGCCCGTAATCTCAACATCGCCGCTTCTTTTTTCACCATCATTACTATTATTGTTGTGTTAATCATTTTACCACCTACATCCTGGTCACAGAACAGAGGCTGATAGTGAGGATGACGAGCAGCCACTGCTTCCTCATCAGTTGGAAGAAAGCCGACTTCTGGAATTATCTTTATGTGTTGCAACCTCAAAATTATTCTGACAGTTTCCACATTTACCATCTGAATTTCCCTTTTATATAGTCTGTTATAGATGGACCTTTTCTAAGCAAATCTTTTTGCAATTGGTCTTTGTTATATATTGCTTGATGGTTTTTGTCCAAAAAAATGCTATCTGGTTGTTTGGGTGAGAGTTTATTGTTTTATTGCCAGATTTTACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCCAAGACAGTCAATAACAACAAAGGGGTGAAGGGAGGATGTTGTATACCGATATCAAATGATCTACCTTACAAGGACCAAACATGGAGTAGATTCAGTTTCGCTTTTTGCCCTGTTTAGCTCAATAAATAATAAAATCCATAGATTTTTCAT
                                                  Xl3.1-CHK-1012699411                                                                                                                                                                                                                                                                                                                                                                                                     CCATGGAGAACACTGACACCACTGATAAGCCTCCTCCGTACATGGTGGAGCCACCTTCTAACTCCGTCAACCAAGGATTTGACCCATCTAGGGCAGGGGTGATGGGGATTCCCAATGTCCCAGCTCCACAAGTCCATACCACAGTGGTGAACATCATTCCCGATGGATTTCTCATACGAGACCACTTGCCATGGTCCATTTTTAACACCATGTACATGAACTTCTGCTGCCTGGGGTTCTTTGCAGTTATTTTCTCTGTAAAGTCCCGGGATCAGAAGGTGATTGGAGACAGGTCTGGAGCCATGAGTTATGCTTCTACTGCCCGTAATCTCAACATCGCCGCTTCTTTTTTCACCATCATTACTATTATTGTTGTGTTAATCATTTTACCACCTACATCCTGGTCACAGAACAGAGGCTGATAGTGAGGATGACGAGCAGCCACTGCTTCCTCATCAGTTGGAAGAAAGCCGACTTCTGGAATTATCTTTATGTGTTGCAACCTCAAAATTATTCTGACAGTTTCCACATTTACCATCTGAATTTCCCTTTTATATAGTCTGTTATAGATGGACCTTTTCTAAGCAAATCTTTTTGCAATTGGTCTTTGTTATATATTGCTTGATGGTTTTTGTCCAAAAAAATGCTATCTGGTTGTTTGGGTGAGAGTTTATTGTTTTATTGCCAGATTTTACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCCAAGACAGTCAATAACAACAAAGGGGTGAAGGGAGGATGTTGTATACCGATATCAAATGATCTACCTTACAAGGACCAAACATGGAGTAGATTCAGTTTCGCTTTTTGCCCTGTTTAGCTCAATAAATAATAAAATCCATAGATTTTTCATGATAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     2     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     5     6     5     6     5     6     6     7     6     7     6     7     5     7     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4
                                               BLH ATG       2      29                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 9e-014     XP_001344342.2 PREDICTED: wu:fa95e04 [Danio rerio] ========================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 2e-017     XP_001234446.1 PREDICTED: similar to 6330512M04Rik protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Cf ---- 4e-020     XP_540516.1 PREDICTED: similar to inteferon-induced membrane protein Leu-13/9-27 [Canis familiaris] ============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 3e-020     NP_006426.2 interferon induced transmembrane protein 2 (1-8D) [Homo sapiens] ====================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ---- 2e-021     XP_001253014.1 PREDICTED: similar to interferon-induced protein 1-8U [Bos taurus] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 4e-022     NP_001106186.1 interferon induced transmembrane protein 1 [Mus musculus] ===================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xt ---- 3e-030     NP_001015758.1 MGC107971 protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Xl ==== 9e-079     NP_001091215.1 hypothetical protein LOC100036989 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8074547.3                                                                                                                                                                                                                                                                                                                                                                                                 ATG---ATG------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------TGATAGTGA---TGA---------------------------------------------------------ATG---------------------------------------------TGA------------------------TAGATG---------TAA------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TAA------------ATG---------------------------------TAA---------------------ATG------------------TGA---------------------ATG---TAG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   1       add Skin 5x3                        IMAGE:8642779.5p                                                                                                                                                                                                                                                                                                                                                                                ATTTCTGTTATGAAAAGATGTCCATGGAGAACACTGACACCACTGATAAGCCTCCTCCGTACATGGTGGAGCCACCTTCTAACTCCGTCAACCAAGGATTTGACCCATCTAGGGCAGGGGTGATGGGGATTCCCAATGTCCCAGCTCCACAAGTCCATACCACAGTGGTGAACATCATTCCCGATGGATTTCTCATACGAGACCACTTGCCATGGTCCATTTTTAACACCATGTACATGAACTTCTGCTGCCTGGGGTTCTTTGCAGTTATTTTCTCTGTAAAGTCCCGGGATCAGAAGGTGATTGGAGACAGGTCTGGAGCCATGAGTTATGCTTCTACTGCCCGTAATCTCAACATCGCCGCTTCTTTTTTCACCATCATTACTATTATTGTTGTGTTAATCATTTTACCACCTACATCCTGGTCACAGAACAGATGCTGATAGTGAGGATGACTAGCAGCCACTGCTTCCTCATCATTTGTAATAAAGCCGACTTCTGTAATTATCTTTATGTGATGCAACCTCAAAATTACTCTAACAGTTTCCGTGTTTACAATCCGAAATACCCTTTCATACTGTTAGTTATAAACCGATCTTAACTAATTTTGATTGTTTGAACTTGCTCATATATTTATTCTCAAATATTTATGCATCATATATATTCGTTTATTAGACTATCTCTGTTTCTTTCTATTTTATTACAATCCTCTACTAGTCATCATCTTTCTATTCATCCCTCTTACTGATCCTATTCTTTCATCATCTCATA
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074547.5p                                                                                                                                                                                                                                                                                                                                                                                               AGATGTCCATGGAGAACACTGACACCACTGATAAGCCTCCTCCGTACATGGTGGAGCCACCTCCTAACTCCGTCAACCAAGGATTTGACCCATCTAGGGCAGGGGTGATGGGGATTCCCAATGTCCCAGCTCCACAAGTCCATACCACAGTGGTGAACATCATTCCCGATGGATTTCTCATACGAGACCACTTGCCATGGTCCATTTTTAACACCATGTACATGAACTTCTGCTGCCTGGGGTTCTTTGCAGTTATTTTCTCTGTAAAGTCCCGGGATCAGAAGGTGATTGGAGACAGGTCTGGAGCCATGAGTTATGCTTCTACTGCCCGTAATCTCAACATCGCCGCTTCTTTTTTCACCATCATTACTATTATTGTTGTGTTAATCATTTTACCACCTACATCCTGGTCACAGAACAGAGGCTGATAGTGAGGATGACGAGCAGCCACTGCTTCCTCATCAGTTGGAAGAAAGCCGACTTCTGGAATTATCTTTATGTGTTGCAACCTCAAAATTATTCTGACAGTTTCCACATTTACCATCTGAATTTCCCTTTTATATAGTCTGTTATAGATGGACCTTTTCTAAGCAAATCTTTTTGCAATTGGTCTTTGTTATATATTGCTTGATGGTTTTTGTCCAAAAAAATGCTATCTGGTTGTTTGGGTGAGAGNTTATTGTTTTATTGCCAGATTTTACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCAAGACAGTCATAACAAC
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGGGATCCCATGTCCCAGTCTACAGTCCCTACCACAGTGTGAACATCATCTCGAGGATGTCTCATACGAGACACTTGCCATGGTCATTTTTAACACCATGTACATGAACTTCTGCTGCCTGGGGTTCTTTGCAGTTATATTCTCTGTAAAGTCCCGGGATCAGAAGGTGATTGGAGACAGGTCTGGAGCCATGAGTTATGCTTCTACTGCCCGTAATCTCAACATCGCCGCTTCTTTTTTCACCATCATTACTATTATTGTTGTGTTAATCATTTTACCACCTACATCCTGGTCACAGAACAGAGGCTGATAGTGAGGATGACGAGCAGCCACTGCTTCCTCATCAGTTGGAAGAAAGCCGACTTCTGGAATTATCTTTATGTGTTGCAACCTCAAAATTATTCTGACAGTTTCCACATTTACCATCTGAATTTCCCTTTTATATAGTCTGTTATAGATGGACCTTTTCTAAGCAAATCTTTTTGCAATTGGTCTTTGTTATATATTGCTTGATGGTTTTTGTCCAAAAAAATGCTATCTGGTTGTTTGGGTGAGAGTTTATTGTTTTATTGCCAGATTTTACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCCAAGACAGTCAATAACAACAAAGGGGTGAAGGGAGGATGTTGTATACCGATATCAAAAGATCTACCTTACAAGGACCAAACACGGAGNAGATCANGNNCNC
  5   1   2      seed Li1                    IMAGE:3396876-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTGAGAGTTTATTGTTTTATTGCCAGATTTTACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCCAAGACAGTCAATAACAACAAAGGGGTGAAGGGAGGATGTTGTATACCGATATCAAATGATCTACCTTACAAGGACCAAACATGGAGTAGATTCAGTTTCGCTTTTTGCCCTGTTTAGCTCAATAAATAATAAAATCCATAGATTTTTCATGATaaaaaaaaaaaaaaa
  5   1   2       bld Li1                    IMAGE:3396877-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTGAGAGTTTATTGTTTTATTGCCAGATTTTACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCCAAGACAGTCAATAACAACAAAGGGGTGAAGGGAGGATGTTGTATACCGATATCAAATGATCTACCTTACAAGGACCAAACATGGAGTAGATTCAGTTTCGCTTTTTGCCCTGTTTAGCTCAATAAATAATAAAATCCATAGATTTTTCATGATaaaaaaaaaaaaaaa
  5   1   2       bld Li1       in                    IMAGE:3396877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGAGTTTATTGTTTTATTGCCAGATTTTACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCCAAGACAGTCAATAACAACAAAGGGGTGAAGGGAGGATGTTGTATACCGATATCAAATGATCTACCTTACAAGGACCAAACATGGAGTAGATTCAGTTTCGCTTTTTGCCCTGTTTAGCTCAATAAATAATAAAATCCATAGATTTTTCATGATAAAA
  3   1   2       bld Li1       in                    IMAGE:3396877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTCCATGTTTCATCCATGCGAAGTAGATAGATTACCGGTACACAAATAATTTTCTTGCATAATGGATTCCTGTGTATATGTAAGCCAAGACAGTCAATAACAACAAAGGGGTGAAGGGAGGATGTTGTATACCGATATCAAATGATCTACCTTACAAGGACCAAACATGGAGTAGATTCAGTTTCGCTTTTTGCCCTGTTTAGCTCAATAAATAATAAAATCCATAGATTTTTCATGATAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)