Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 95%

 1012788304 Xl3.1-IMAGE:3437167-IMAGp.5 - 5 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     3     4     4     4     2     4     3     4     3     4     2     3     2     3     2     3     3     4     2     4     2     4     2     4     3     4     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2
                                               BLH ATG     403     391                                                                                                           
                                               BLH MIN     403      60                                                                                                           
                                               BLH MPR     193      60                                                                                                           
                                               BLH OVR     403     843                                                                                                           
                                               CDS MIN     403      60                                                                                                           
                                               ORF LNG     403      20                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 4e-007     NP_493582.3 SeMaPhorin related family member (smp-1) [Caenorhabditis elegans] -----------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 2e-010     NP_001033952.1 CG33960-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 2e-011     XP_316667.4 AGAP006636-PA [Anopheles gambiae str. PEST] ------------============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - ?? ---- 2e-012     XP_604387.4 PREDICTED: similar to semaphorin 4C [Bos taurus] -------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Xt ---- 2e-039     NP_001011157.1 hypothetical LOC496575 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 2e-048     XP_692847.2 PREDICTED: semaphorin 3c [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bt ==== 2e-066     NP_001094552.1 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Bos taurus] =============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 1e-067     NP_989574.1 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Gallus gallus] =============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 9e-069     NP_038685.3 semaphorin 3C; semaphorin E [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 3e-069     NP_006370.1 semaphorin 3C [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 2e-069     XP_533139.2 PREDICTED: similar to semaphorin 3C [Canis familiaris] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Xl ==== 6e-081     NP_001088402.1 hypothetical protein LOC495257 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3437167-IMAGp.5                                                                                                                                                                                                                                                                                                                                                      TAA------------------------------------------------------------------------------------------ATG------------TGA---------------------------------------TAA---------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  3   1   1       add Ooc3      in                    IMAGE:3437167.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGTTGAAGAGTCCACGATGGCTGGCACAGATCCAACACAAGGCTGTGAAAACTTTGTGCGTGTAATTCAGAATTTCAACCGAACACATTTGTATGTATGTGGCAGTGGCGCATTCAGCCCTGTTTGTACATATATCAATAGAGGCCGTAGGTCTGAGGATCGTATTTTTGCAATTGATTACAAGAATGAATCGGGCAAAGGACGCTGCTCTTTTAACCCCAAAGTGAACACCGTTTCAGTTATGATTAATGAAGAGTTATTTTCTGGAATGTATATAGACTTCATGGGCACTGACTCTGCCATATTCCGAAGTCTCACAAAACGTAATGCAGTCAGAACAGATCAACACAACTCAAAATGGCTGAGTGAGCCAATCTTTGTGGATGCACAGCTACTTCCAGATGGAACAGATCCTAATGACGCAAAGGTTTATTTCTTCTTGAAGGAGCGACTGACTGATAACACTGGGAGCACGAAGCAAATACATTCCATGATAGCAAGAGTCTGCCCTGTAAGATGTCTTTATTCATTTATAACAGACTGTCTATAATCTAATAAAATCTAATAATTATAGTAAGTCTGTTCTGTGTAAGTACATTTCCTGTGCCTGTTGAGTAAGGGAATGGAAGACATAAACTAATAAACAGGTTCCTGACTGCTATGTGTGCATTTCAGATATGAGTCAAATTTATACTCATGTTATTTCTATAAATAAATTCTATTATTTATGAAAAAAAAA

In case of problems mail me! (