Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 30 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012788304 Xl3.1-IMAGE:3437167-IMAGp.5 - 5 ESTs
                                                                       ......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3437167-IMAGp.5                                                                                                           AGTCTGTGTGTGTCTGTGTGTGTGTGTGAGAGGAGGCTTTTGGTTTCAGGCGGAGCGGCAGGGCCAGAGCCGCGTGTGTAACTGGAAACCGACGTCTCTTTCTCCCCTGTCACACACTCGCCTACTTTCCATTCACTCCCAAGCTGAGGAGTCGGCGCGGGTTCGGGAAAGAGAGAGAGAAGAGCTGACAGACGCAATAGGAGTTTGTAAGAAAGGATTATTTCCCAAAATCCCCTAACAGGCGGCACATGGGCTAATAAGAAAAGAGTTTGGGATTAGAAGGCTCTGCTGGAAGCATATAATCTTGGACGTGAAGCGGCAGGTTTTAATGGCTGAGCTCTCGTGATTCCTTCCTTCCAAACTTGGGTTTCGTCATCTGGATAAATAAAAACATTTCACCAAAATGGCAGTTACAACCATTGAAGTGCTGATTGGCCTGGTATTATGTTCAGCCTGTGTTACAGGAATGCCACAAGCAAGAGTTTTTCTGACATTCAGTGAACTTCAAGAAACTAAAACCTCTGAATACTACAGTATATCCCATAGCCCATTGGATTACAGGATTTTATTCATGGATGAGGATCAAGACAGAATCTATGTTGGCAGCAAAGATCATATTTTGTCTTTGAATATTAACAATATAAGCCACGATCCTCTAAGTGTTTTCTGGCCTGCTTCAGCTAGCAAAGTTGAAGAGTGCAAGATGGCTGGCAAAGATCCCACACATGGCTGTGGAAACTTTGTGCGTGTAATTCAGAATTTCAACCGAACACATTTGTATGTATGTGGCAGTGGCGCATTCAGCCCTGTTTGTACATATATCAATAGAGGCCGTAGGTCTGAGGATCGTAT
                                                  Xl3.1-CHK-1012704494                                                                                                                 TGTGTGTCTGTGTGTGTGTGTGAGAGGAGGCTTTTGGTTTCAGGCGGAGCGGCAGGGCCAGAGCCGCGTGTGTAACTGGAAACCGACGTCTCTTTCTCCCCTGTCACACACTCGCCTACTTTCCATTCACTCCCAAGCTGAGGAGTCGGCGCGGGTTCGGGAAAGAGAGAGAGAAGAGCTGACAGACGCAATAGGAGTTTGTAAGAAAGGATTATTTCCCAAAATCCCCTAACAGGCGGCACATGGGCTAATAAGAAAAGAGTTTGGGATTAGAAGGCTCTGCTGGAAGCATATAATCTTGGACGTGAAGCGGCAGGTTTTAATGGCTGAGCTCTCGTGATTCCTTCCTTCCAAACTTGGGTTTCGTCATCTGGATAAATAAAAACATTTCACCAAAATGGCAGTTACAACCATTGAAGTGCTGATTGGCCTGGTATTATGTTCAGCCTGTGTTACAGGAATGCCACAAGCAAGAGTTTTTCTGACATTCAGTGAACTTCAAGAAACTAAAACCTCTGAATACTACAGTATATCCCATAGCCCATTGGATTACAGGATTTTATTCATGGATGAGGATCAAGACAGAATCTATGTTGGCAGCAAAGATCATATTTTGTCTTTGAATATTAACAATATAAGCCACGATCCTCTAAGTGTTTTCTGGCCTGCTTCAGCTAGCAAAGTTGAAGAGTGCAAGATGGCTGGCAAAGATCCCACACATGGCTGTGGAAACTTTGTGCGTGTAATTCAGAATTTCAACCGAACACATTTGTATGTATGTGGCAGTGGCGCATTCAGCCCTGTTTGTACATATATCAATAGAGGCCGTAGGTCTGAGGATCGTATTTTTGC
                                                      consensus depths                                                                                                                2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     3     4     4     4     2     4     3     4     3     4     2     3     2     3     2     3     3     4     2     4     2     4     2     4     3     4     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2
                                               BLH ATG     403     391                                                                                                           
                                               BLH MIN     403      60                                                                                                           
                                               BLH MPR     193      60                                                                                                           
                                               BLH OVR     403     843                                                                                                           
                                               CDS MIN     403      60                                                                                                           
                                               ORF LNG     403      20                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 4e-007     NP_493582.3 SeMaPhorin related family member (smp-1) [Caenorhabditis elegans] -----------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 2e-010     NP_001033952.1 CG33960-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 2e-011     XP_316667.4 AGAP006636-PA [Anopheles gambiae str. PEST] ------------============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - ?? ---- 2e-012     XP_604387.4 PREDICTED: similar to semaphorin 4C [Bos taurus] -------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Xt ---- 2e-039     NP_001011157.1 hypothetical LOC496575 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 2e-048     XP_692847.2 PREDICTED: semaphorin 3c [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bt ==== 2e-066     NP_001094552.1 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Bos taurus] =============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 1e-067     NP_989574.1 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Gallus gallus] =============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 9e-069     NP_038685.3 semaphorin 3C; semaphorin E [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 3e-069     NP_006370.1 semaphorin 3C [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 2e-069     XP_533139.2 PREDICTED: similar to semaphorin 3C [Canis familiaris] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Xl ==== 6e-081     NP_001088402.1 hypothetical protein LOC495257 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3437167-IMAGp.5                                                                                                                                                                                                                                                                                                                                                      TAA------------------------------------------------------------------------------------------ATG------------TGA---------------------------------------TAA---------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  5   1   2       bld Emb1 5x                         IMAGE:5157372.5p GCAGTGCTGGCTGGGTGTGGCTGATACATTATGTAGGAGCTTGAGGCTTGTTTGCTGCTCTGTGCTTGACTCTGGTCTCAGTGTGTGAGAGGTTTAGGTTTTCTCAGTGTGTGTGAGGTTAAGGTTTTCTCAGTGTTAgtgtgtgtgtgtgtgtgAAGAGTCTTTGGTTTCAGGCAGAGCGGCAGGGCCAGAGACGCGCGTGTAACTGGAAACCAAGGTCTCTTTCTCCGCTGTCACACACTCGCCTACTTTCCATTCACTCCCAAACTGAGGAGTCGGCGGGTTCCGGAAAGAGAGAAGAGCTGACAGACGCACTAGGGGTTTGGAAGAAAGGATTTATTCCCAAAGTCCCCTAACAGGCGGCACATGGGTTAATAACAAAGGAGTTCGAAGGAAAGGAGCACCATCATCTTGGACGTGAGGCGGCAGGTTAAATGGCTGATCTCTTGTGATTCCTTCCTTCCAAACTTGGGTTTCATCATCTGGATAAATAAAAACATTTCACCAAAATGGCAGTTACAACCATCCAAGTGCTGATTGGCCTGGCATTATGTTCAGCCTGTGTTACAGGAATGCCACAAGCAAGAGTTTTTCTGACATTCAATGACCTTCAGGAAACTAAAACCTCTGAATACTACAGTATATCTCAGAATCCATTAGATTACAGGATTTTATTCATGGATGAGGATCAAGACAGAATCTATGTTGGCAGCAAGGATCATATTTTGTCTTTGAATATTACCAATATAAACCACGATCCCTCTCAGTGGTTTTCTGGGCCCTGCTTCTTACTACCAAAAGTTTGAAGCAGTGGCAAAGAATGGGCTGTGCCAAAAGATTCCTTACACATTGGGCGTGTGGAAAAACTTTTGCGGCGGTGTGAATTTCCAGAAAATGTCCAACCCGGAAAAACCAATTTTTGTAAA
  5   1   2      seed Ooc3 5g                IMAGE:3437167-IMAGp.IMAGp                                                                                   CTGGAATTCCCTCGGGCTTGGCTCAGTCtgtgtgtgtctgtgtgtgtgtgtgAGAGGAGGCTTTTGGTTTCAGGCGGAGCGGCAGGGCCAGAGCCGCGTGTGTAACTGGAAACCGACGTCTCTTTCTCCCCTGTCACACACTCGCCTACTTTCCATTCACTCCCAAGCTGAGGAGTCGGCGCGGGTTCGGGAaagagagagagaagagCTGACAGACGCAATAGGAGTTTGTAAGAAAGGATTATTTCCCAAAATCCCCTAACAGGCGGCACATGGGCTAATAAGAAAAGAGTTTGGGATTAGAAGGCTCTGCTGGAAGCATATAATCTTGGACGTGAAGCGGCAGGTTTTAATGGCTGAGCTCTCGTGATTCCTTCCTTCCAAACTTGGGTTTCGTCATCTGGATAAATAAAAACATTTCACCAAAATGGCAGTTACAACCATTGAAGTGCTGATTGGCCTGGTATTATGTTCAGCCTGTGTTACAGGAATGCCACAAGCAAGAGTTTTTCTGACATTCAGTGAACTTCAAGAAACTAAAACCTCTGAATACTACAGTATATCCCATAGCCCATTGGATTACAGGATTTTATTCATGGATGAGGATCAAGACAGAATCTATGTTGGCAGCAAAGATCATATTTTGTCTTTGAATATTAACAATATAAGCCACGATCCTCTAAGTGTTTTCTGGCCTGCTTCAGCTAGCAAAGTTGAAGAGTGCAAGATGGCTGGCAAAGATCCCACACATGGCTGTGGAAACTTTGTGCGTGTAATTCAGAATTTCAACCGAACACATTTGTATGTATGTGGCAGTGGCGCATTCAGCCCTGTTTGTACATATATCAATAGAGGCCGTAGGTCTGAGGATCGTATTTTTGCATTGATTACAAGAATGAATCGGGCAAAGGACGCTGCTCTTTTAACCCCAAAGTGAACACCGTTT
  5   1   2       bld Ooc3      in                    IMAGE:3437167.5p                                                                                                    TTGGCTCAGTCtgtgtgtgtctgtgtgtgtgtgtgAGAGGAGGCTTTTGGTTTCAGGCGGAGCGGCAGGGCCAGAGCCGCGTGTGTAACTGGAAACCGACGTCTCTTTCTCCCCTGTCACACACTCGCCTACTTTCCATTCACTCCCAAGCTGAGGAGTCGGCGCGGGTTCGGGAaagagagagagaagagCTGACAGACGCAATAGGAGTTTGTAAGAAAGGATTATTTCCCAAAATCCCCTAACAGGCGGCACATGGGCTAATAAGAAAAGAGTTTGGGATTAGAAGGCTCTGCTGGAAGCATATAATCTTGGACGTGAAGCGGCAGGTTTTAATGGCTGAGCTCTCGTGATTCCTTCCTTCCAAACTTGGGTTTCGTCATCTGGATAAATAAAAACATTTCACCAAAATGGCAGTTACAACCATTGAAGTGCTGATTGGCCTGGTATTATGTTCAGCCTGTGTTACAGGAATGCCACAAGCAAGAGTTTTTCTGACATTCAGTGAACTTCAAGAAACTAAAACCTCTGAATACTACAGTATATCCCATAGCCCATTGGATTACAGGATGTTATTCATGGATGACGATCAAGACAGAATCTATGTTGGCAGCAAAGATCATATTGTGTCGTTGAATATTAACAATATAAGCCACGATCCTCTAAGTGATTTCTGGCCTGCTTCAGCTAGCATAGTTGAAGAGTGCAAGATGGCTGGCAAAGATCGCACACATGGGTGTGGAAACTNTGTGCGTGTAATTCAGAATCTCAAC
  5   1   2       bld Ooc3 5g                         IMAGE:3437169.5p                                                                                                                                   TGTGAGAGGAGGCTTTTGGTTTCAGGCGGAGCGGCAGGGCCAGAGCCGCGTGTGTAACTGGAAACCGACGTCTCTTTCTCCCCTGTCACACACTCGCCTACTTTCCATTCACTCCCAAGCTGAGGAGTCGGCGCGGGTTCGGGAaagagagagagaagagCTGACAGACGCAATAGGAGTTTGTAAGAAAGGATTATTTCCCAAAATCCCCTAACAGGCGGCACATGGGCTAATAAGAAAAGAGTTTGGGATTAGAAGGCTCTGCTGGAAGCATATAATCTTGGACGTGAAGCGGCAGGTTTTAATGGCTGAGCTCTCGTGATTCCTTCCTTCCAAACTTGGGTTTCGTCATCTGGATAAATAAAAACATTTCACCAAAATGGCAGTTACAACCATTGAAGTGCTGATTGGCCTGGTATTATGTTCAGCCTGTGTTACAGGAATGCCACACGCAAGAGTTTTTCTGACATTCAGTGAACTTCAAGAAACTAAAACCTCTGAATACTACAGTATATCCCATAGCCCATTGGATTACAGGATGTTATTCATGGATGAGGATCAAGACAGAATCTATGTTGGCAGCAGAGATCATATTGTGTCTGTGAATATTAACAGTATAAGCCACGATCCTCTAAGTGTT
  3   1   1       add Ooc3      in                    IMAGE:3437167.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGTTGAAGAGTCCACGATGGCTGGCACAGATCCAACACAAGGCTGTGAAAACTTTGTGCGTGTAATTCAGAATTTCAACCGAACACATTTGTATGTATGTGGCAGTGGCGCATTCAGCCCTGTTTGTACATATATCAATAGAGGCCGTAGGTCTGAGGATCGTATTTTTGCAATTGATTACAAGAATGAATCGGGCAAAGGACGCTGCTCTTTTAACCCCAAAGTGAACACCGTTTCAGTTATGATTAATGAAGAGTTATTTTCTGGAATGTATATAGACTTCATGGGCACTGACTCTGCCATATTCCGAAGTCTCACAAAACGTAATGCAGTCAGAACAGATCAACACAACTCAAAATGGCTGAGTGAGCCAATCTTTGTGGATGCACAGCTACTTCCAGATGGAACAGATCCTAATGACGCAAAGGTTTATTTCTTCTTGAAGGAGCGACTGACTGATAACACTGGGAGCACGAAGCAAATACATTCCATGATAGCAAGAGTCTGCCCTGTAAGATGTCTTTATTCATTTATAACAGACTGTCTATAATCTAATAAAATCTAATAATTATAGTAAGTCTGTTCTGTGTAAGTACATTTCCTGTGCCTGTTGAGTAAGGGAATGGAAGACATAAACTAATAAACAGGTTCCTGACTGCTATGTGTGCATTTCAGATATGAGTCAAATTTATACTCATGTTATTTCTATAAATAAATTCTATTATTTATGAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)