Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7978340.5                       2 PI      90          1      824                forkhead box protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012788449 Xl3.1-IMAGE:4203022-IMAGp.5 - 8 ESTs
                                                                       ..-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4203022-IMAGp.5                                           ATCTCCCTACCACCTCTGCTGCAGCTACTGCTGTTCCAGAACCTTCTTGCTTAATTCTGCTGCATCCTGACCCACTGTCTATCAGGAGCAGTTCTTGGATCCCAAGGGCTTTATTAATGTTTGACCTGCCCACGGTGGCCCCGTTAGACATGGAGGACAGCTGGGTGACTTTCCAGGCCGAGGGAGATCAGGGGCAAGATTCCTTTTCTAGCTCAGTTAACCTGGATGATAGCCTCACCAGCCTGCAGTGGCTACAAGAATTCTCCATACTCAATGCCAACGTGGGTAAGACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCACCTGTCTGGCGCTCCCTGTTCTCCTCTGGCTGCTGACCCCGCTTGCCTGGGCATGCCACATACTCCAGGAAAACCCATATCCTCATCCACCTCACGGGCATCCCACTTGGGGCTCCAGCCAATGGAGGAGATTGACTACAAAACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACCCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTGTCTGCCATTTACAAGTGGATCACGGACAACTTCTGCTACTTCCGGCATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCTTAAATAAGTGTTTCATCAAAGTCCCTCGGGAAAAAGACGAGCCAGGCAAAGGAGGCTTCTGGAAGATTGATCCACAATATGCCGATCGCCTCATGAACGGAGCCATGAAGAAGCGCCGACTTCCACCTGTCCAGATCCATCCGGCCTTTGCTAGTGCTCAGGCTGCAGCCTCCAGTAATGGCAACAGAGCTTCTGCCTGGCAGATGAGTGTTAATTCAGAGTCCCACAAACTGCTGAAGGAGTTTGAGGAGATAACAAGTGAGCAAAGCTGGAATGCACTAGGAGAACATGGCTGGAATGCCATAAGTGATGGGAAATCTCACAAGCGCAAGCAGCCTTTGCCCAAACGCATGTTTAAGGCCCCACGTCTCTCCAGCTCCCCTATGCTCTCCCAAGAGGAGCAAACTGAATTGGGGTCCTTGAAAGGTGATTTTGACTGGGAAGTTATCTTTGACTCTTCAATCAACGGATTTAACTTCTCAGCCTTTGAGGACCTAGAAGTCACCCCTCCCCTGAATCCAGTTACACGCTCTGTTGACCTCACCGTTCATGGAAAGCACATTGACTGCCCACAGCAGTGGTACCCAATGGGACAGGATCTCATTGGGGGGGCGCAAAAAAAGCATTTCGATGAGACATTACTTGCCACCTCCTTCCTCCAGCACCCATGGGAAGAGAACAGGAATGATTATCTGTCCAACTCTGCCAATATTGAACAGCTTTTTGATCTCAATGAGGCATTTCCGGCAGAGCTCAATGACTGGTCGTCCTTGGGTTCCTATATATAATGTTGCCATACTAAACTAAACAGAGACAAAAATAGACATTTATATAAATAAATATATATATTTACTAAGAAGGACATTTCTGAACATTTTAAATAAAGGTAAATCCTTTTGCAGAGCAGAGGGTACCTATTCTAAAATTTACACTATTTAGGAATAGATAGAATCTATTCCGCTGAAAATGGCCTGAGCTAACGGGCAGCAAATATGCTGGACAGAAGACTGTGTGACATGGCCACAATGAAAA
                                                  Xl3.1-CHK-1012697755                                                 CTACCACCTCTGCTGCAGCTACTGCTGTTCCAGAACCTTTTTGCTTAATTCTGCTGCATCCTGACCCACTGTCTATCAGGAGCAGTTCTTGGATCCCAAGGGCTTTATTAATGTTTGACCTGCCCACGGTGGCCCCGTTAGACATGGAGGACAGCTGGGTGACTTTCCAGGCCGAGGGAGATCAGGGGCAAGATTCCTTTTCTAGCTCAGTTAACCTGGATGATAGCCTCACCAGCCTGCAGTGGCTACAAGAATTCTCCATACTCAATGCCAACGTGGGTAAGACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCACCTGTCTGGCGCTCCCTGTTCTCCTCTGGCTGCTGACCCCGCTTGCCTGGGCATGCCACATACTCCAGGAAAACCCATATCCTCATCCACCTCACGGGCATCCCACTTGGGGCTCCAGCCAATGGAGGAGATTGACTACAAAACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACCCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTGTCTGCCATTTACAAGTGGATCACGGACAACTTCTGCTACTTCCGGCATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCTTAAATAAGTGTTTCATCAAAGTCCCTCGGGAAAAAGACGAGCCAGGCAAAGGAGGCTTCTGGAAGATTGATCCACAATATGCCGATCGCCTCATGAACGGAGCCATGAAGAAGCGCCGACTTCCACCTGTCCAGATCCATCCGGCCTTTGCTAGTGCTCAGGCTGCAGCCTCCAGTAATGGCAACAGAGCTTCTGCCTGGCAGATGAGTGTTAATTCAGAGTCCCACAAACTGCTGAAGGAGTTTGAGGAGATAACAAGTGAGCAAAGCTGGAATGCACTAGGAGAACATGGCTGGAATGCCATAAGTGATGGGAAATCTCACAAGCGCAAGCAGCCTTTGCCCAAACGCATGTTTAAGGCCCCACGTCTCTCCAGCTCCCCTATGCTCTCCCAAGAGGAGCAAACTGAATTGGGGTCCTTGAAAGGTGATTTTGACTGGGAAGTTATCTTTGACTCTTCAATCAACGGATTTAACTTCTCAGCCTTTGAGGACCTAGAAGTCACCCCTCCCCTGAGTCCAGTTACACGCTCTGTTGACCTCACCGTTCATGGAAAGCACATTGACTGCCCACAGCAGTGGTACCCAATGGGACxxGxxxTCATTGGGGGGGCGCAAAxxxxGxATTTCGATGAGACATTACTTGCCACCTCCTTCCTCCAGCACCCATGGGAAGAGAACAGGAATGATTATCTGTCCAACTCTGCCAATATTGAACAGCTTTTTGATCTCAATGAGGCATTTCCGGCAGAGCTCAATGACTGGTCGTCCTTGGGTTCCTATATATAATGTTGCCATACTAAACTAAACAGAGACAAAAATAGACATTTATATAAATAAATATATATATTTACTAAGAAGGACATTTCTGAACATTTTAAATAAAGGTAAATCCTTTTGCAGAGCAGAGGGTACCTATTCTAAAATTTACACTATTTAGGAATAGATAGAATCTATTCCGCTGAAAATGGCCTGAGCTAGCGGGCAGCAAATATGCTGGACAGAAGACTGTGTGACATGGCCACAA
                                                      consensus depths                                                2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     4     4     4     4     3     4     2     4     3     4     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     2     3     2     3     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     2     2     2     2
                                               BLH ATG     116    1094                                           
                                               BLH MIN     116     168                                           
                                               BLH MPR      47     168                                           
                                               BLH OVR     116     247                                           
                                               CDS MIN     116     168                                           
                                               ORF LNG     116      17                                           
                                                                                                                                                                            PROTEIN --- Ce ---- 1e-024     NP_001041116.1 defective PHArynx development family member (pha-4) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 2e-025     NP_523814.1 forkhead domain 59A CG3668-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN --- Ag ---- 4e-027     XP_314703.4 AGAP008606-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PREDICTED = ?? ==== 1e-027     XP_612715.3 PREDICTED: similar to Forkhead box protein J2 (Fork head homologous X) [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                PROTEIN --- Ci ---- 7e-029     NP_001071712.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                    PROTEIN --- Sp ---- 3e-051     NP_001073013.1 forkhead transcription factor J1 [Strongylocentrotus purpuratus] ------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                 PROTEIN --- Dr ---- 7e-115     NP_001070174.2 forkhead box transcription factor J1 [Danio rerio] -----------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 3e-137     NP_032266.2 forkhead box J1 [Mus musculus] ----------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED = Cf ==== 6e-138     XP_533124.2 PREDICTED: similar to Forkhead box protein J1 (Forkhead-related protein FKHL13) (Hepatocyte nuclear factor 3 forkhead homolog 4) (HFH-4) [Canis familiaris] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 9e-140     NP_001445.2 forkhead box J1; forkhead (Drosophila)-like 13 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED = Bt ==== 1e-140     XP_582255.2 PREDICTED: similar to Forkhead box protein J1 (Forkhead-related protein FKHL13) (Hepatocyte nuclear factor 3 forkhead homolog 4) (HFH-4) [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 2e-159     XP_001233327.1 PREDICTED: similar to Forkhead box protein J1 (FoxJ1) [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          Q5M7N6 Forkhead box protein J1 (FoxJ1) [Xenopus tropicalis]  =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                     PROTEIN === Xl ==== 0          NP_001083644.1 forkhead box protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4203022-IMAGp.5                                                                                                                                                               ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAA------------------------------------------TAA---TAA------------------------------TAA------------------------------------------------------TAA------------ATG---------------------ATG------ATG
                                                                   ORF                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   1       add Emb4 5x3  out                   IMAGE:4203022.5p AATTCCAGGGCTATCGNCGACCCACGCGTCCGGCAATAACTCATCTCCCTACCACCTCTGCTGCAGCTACTGCTGTTCCAGAACCTTTTTGCTTAATTCTGCTGCATCCTGACCCACTGTCTATCAGGAGCAGTTTTTGGATCCCAAGGGCTTTATTAATGGGGGATCTGCCCACGGTGGCCCCGNTAGACATGGAGGACAGNTGGGTGACTTTCCAGCCCGCGGGAGATCAGGCCCAAGATTCCTTTTCTAGCTCAGTTAACCTGGATGATNGNCTCACCAGNCTGaaaaaaaaaaaaGAATNNTNCATACTNANTGCCNACGGGGGNANGGACGNNTTTTTTNTTTGGGGACCTT
  5   1   1       add Em10 5g                         IMAGE:7980267.5p                               GATCAATAACTCATCTCCCTACCACCTCTGCTGCAGCTGCTGCTGTTCCAGAACCTTCTTGCTTAGTTCTGCTGCATCCTGACCCACTGTCTATCAGGAGCAGTTCTTGGATCCCAAGGGCTTTATTAATGTTTGACCTGCCCACGGTGGCCCCGTTAAACATGGAGGAAAGCTGGGTGACTTTCCAGTCCGAAAGAGATCTGGGGGAAGATTCCTTTTCTAGCTCAATTAACCTGAATGATAGCCTCACCACCCTGTAATGTCTACAATAATTCTCCAATACTC
  5   1   2       bld Ga12 5g                              XL143m15.5p                                          GCATCTCCCTACCCCTCTGCTGCAGCTACTGCTGTTCCAGAACCTTCTTGCTTAATTCTGCTGCATCCTGACCCACTGTCTATCAGGAGCAGTTCTTGGATCCCAAGGGCTTTATTAATGTTTGACCTGCCCACGGTGGCCCCGTTAGACATGGAGGACAGCTGGGTGACTTTCCAGGCCGAGGGAGATCAGGGGCAAGATTCCTTTTCTAGCTCAGTTAACCTGGATGATAGCCTCACCAGCCTGCAGTGGCTACAAGAATTCTCCATACTCAATGCCAACGTGGGTAAGACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCACCTGTCTGGCGCTCCCTGTTCTCCTCTGGCTGCTGACCCCGCTTGCCTGGGCATGCCACATACTCCAGGAAAACCCATATCCTCATCCACCTCACGGGCATCCCACTTGGGGCTCCAGCCAATGGAGGAGATTGACTACAAAACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACCCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTGTCTGCCATTTACAAGTGGATCACGGACAACTTCTGCTACTTCCGGCATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCT
  5   1   2      seed Emb4 5g                IMAGE:4203022-IMAGp.IMAGp                                                                                                                                                 CAAGGGCTTTATTAATGTTTGACCTGCCCACGGTGGCCCCGTTAGACATGGAGGACAGCTGGGTGACTTTCCAGGCCGAGGGAGATCAGGGGCAAGATTCCTTTTCTAGCTCAGTTAACCTGGATGATAGCCTCACCAGCCTGCAGTGGCTACAAGAATTCTCCATACTCAATGCCAACGTGGGTAAGACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCACCTGTCTGGCGCTCCCTGTTCTCCTCTGGCTGCTGACCCCGCTTGCCTGGGCATGCCACATACTCCAGGAAAACCCATATCCTCATCCACCTCACGGGCATCCCACTTGGGGCTCCAGCCAATGGAGGAGATTGACTACAAAACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACCCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTGTCTGCCATTTACAAGTGGATCACGGACAACTTCTGCTACTTCCGGCATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCTTAAATAAGTGTTTCATCAAAGTCCCTCGGGAAAAAGACGAGCCAGGCAAAGGAGGCTTCTGGAAGATTGATCCACAATATGCCGATCGCCTCATGAACGGAGCCATGAAGAAGCGACGACTTCCACCTGTCCAGATCCATCCGGCCTTTGCTAGTGCTCAGGCTGCAGCCTCCAGTAATGGCAACAGAGCTTCTGCCTGGCAGATGAGTGTTAATTCAGAGTCCCACAAACTGCTGAAGGGAGTTTGAGGAGATAACAAGTGAGCAA
  5   1   1       add Em10                            IMAGE:7980331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTCCAATATGTCTTCCACCTTATAACTTGATAATGATAttttttttttCAAAGATTTTTGATTTCCAGAATGATAAATAAATCAATAtttctttctttttttCCAACTAGAATTCTATTAGACACAACCTCTCCTTAAATAAGTGTTTCATCAAAGTCCCTCGGGAAAAAGACGAGCCAGGCAAAGGAGGCTTCTGGAAGATTGATCCACAATATGCCGATCGCCTCATGAACGGAGCCATGAAGAAGCGCCGACTTCCACCTGTCCAGATCCATCCGGCCTTTGCTAGTGCTCAGGCTGCAGCCTCCAGTAATGGCAACAGAGCTTCTGCCTGGCAGATGAGTGTTAATTCAGAGTCCCACAAACTGCTGAAGGAGTTTGAGGAGATAACAAGTGAGCAAAGCTGGAATGCACTAGGAGAACATGGCTGGAATGCCATAAGTGATGGGAAATCTCACAAGCGCAAGCAGCCATTGCCCAAACGCATGTTTAAGGCTCCACGCCTCTCCAGCTCCCCTATGCTCTCCCAAGAGGAGCAAACGGAATTGGGGTCCTTGAAAGGTGATTTTGACTGGGAAGTTATCTTCGACTCTTCAATCAATGGAGTTAACTTCTCGGCCTTTGAGGACCTAGAAGTCACCCCTCCCCTGAGTCCAGTTTCACGCTCTGTTGACCTCACCGTTCATGGAAAGCACATTGACTGCCCACAGCAGTGGTACCCGATGGGACAGGACCC
  5   1   1       add Emb1                            IMAGE:6633819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGAAGACGAGCCAGGCAAAGGAGGTTTCTGGAAGATTGATCCACAATATGCTGATCGGCTCATAAATGGAGCCATGAAGAAGCGCCGACTTCCCCCTGTCCAGATCCATCCGGCATTTGCTAGTGCACAGGCTGCAGCCTCCAGTGATAGCAAAAGAGGTTCTGCCTGGCAGATGAGCGTCAATTCAGAGTCCCACCAACTGCTGAAGGCGTTTGAGGAGATAACAAATGAGCAAGGCTGGAATCCATTAGGAGAACATGGCTGGAATTCCATAAGTGATGGGAAATCTCACAAGCGCAAGCAGCCTTTGCCCAAACGCATGTTTAAGGCCCCACGTCTCTCCAGCTCCCCTATGCTCTCCCAAGAGGAGCAAACTGAATTGGGGTCCTTGAAAGGTGATTTTGACTGGGAAGTTATCTTTGACTCTTCAATCAACGGATTTAACTTCTCAGCCTTTGAGGACCTAGAAGTCCCCCCTCCCCTGAATCCAGTTACACGCTCTGTTGACCTCACCGTTCATGGAAAGCCCATTGACTGCCCACAGCCAGTGGTACCCAATGGGACAGGCATCATTGGGGGGGCGCAAAAAAAGCTTGGGAATTCCGAATGGAAAAATTTACCTTGGCCCCCCTCCTTTCCCTCCCAACAACCCCAATGGGTAAAAAAGAAACAGGGGAACAGGATCTTATTCTGGGCCCCAACTTCCCTGGCCAAAAAATTATGGGAAACAGCACTTTTCTTTCGGAGCCCCCCCAATGGAAGGGGGACTTATTCCCGGGGCCACGAAACGTTCAACAGCGGCACCC
  5   1   1       add Em10                            IMAGE:8320580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCAAGAGGAGCAAACTGAATTGGGGTCCTTGAAAGGTGATTTTGACTGGGAAGTTATCTTTGACTCTTCAATCAACGGATTTAACTTCTCAGCCTTTGAGGACCTAGAAGTCACCCCTCCCCTGAGTCCAGTTACACGCTCTGTTGACCTCACCGTTCATGGAAAGCACATTGACTGCCCACAGCAGTGGTACCCAATGGGACAGGATCATGCGGTGGCGCAAAATAGCTTGGATTTCGATGAGACATTACTTGCCACCTCCTTCCTCCAGCACCCATGGGAAGAGAACAGGAATGATTATCTGTCCAACTCTGCCAATATTGAACAGCTTTTTGATCTCAATGAGGCATTTCCGGCAGAGCTCAATGACTGGTCGTCCTTGGGTTCCTATATATAATGTTGCCATACTAAACTAAACAGAGACAAAAATAGACATTtatataaataaatatatatatTTACTAAGAAGGACATTTCTGAACATTTTAAATAAAGGTAAATCCTTTTGCAGAGCAGAGGGTACCTATTCTAAAATTTACACTATTTAGGAATAGATAGAATCTATTCCGCTGAAAATGGCCTGAGCTAACGGGCAGCAAATATGCTGGACAGAAGACTGTGTGACATGGCCACAATGAAAAGACAGTACTTAATAAAAAACAAAACTTTTGTACTATTTTCTAGTGTTTCAAATGACTTAGTATGCACTGTATCTGGTAGGTGAATCAAGATGGATTCGATCATCGATGAGACGTCTGAAAGGCATGACCTCTCTCGCTCTCGAATTGCATACAGTATTCTACTTTATACC
  3   1   0       add Neu7                                 XL007g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATTTCGATGAGACATTACTTGCCACCTCCTTCCTCCAGCACCCATGGGAAGAGAACAGGAATGATTATCTGTCCAACTCTGCCAATATTGAACAGCTTTTTGATCTCAATGAGGCATTTCCGGCAGAGCTCAATGACTGGTCGTCCTTGGGTTCCTATATATAATGTTGCCATACTAAACTAAACAGAGACAAAAATAGACATTTATATAAATAAATATATATATTTACTAAGAATGACATTTCTGAACATTTTAAATAAAGGTAAATCCTTTTGCAGAGCAGAGGGTACCTATTCTAAAATTTACACTATTTAGGAATAGATAGAATCTATTCCGCTGAAAATGGCCTGAGCTAGCGGGCAGCAAATATGCTGGACAGAAGACTGTGTGACATGGCCACAATGAAAAGAACAGTACTTAAATAAAAAAACAAAACCTTTTTGTACTTATTTTTCTAGGTGTTTTCAAAATGAACTTAGGTATTGCCACTGTATTCTGGGTAGGGTGAGATACAGAGAATGTGATATCAGATCAGTCTGATGTATGATCAGTTCTGGAAAATGTGCAATGTACCCTTCTCTTTTCCGCTTTCTCTGAAAAATTTGCCCATTAACTATGTTAATTTTTCTTATCTTTTTTTAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)