Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 88%

 1012788553 Xl3.1-IMAGE:3200585-IMAGp.5 - 3 ESTs
                                                                       .......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3200585-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGGCTGTGCTGTTTTGAGCACGCCACTTAGCTAGGCTGCCAGAGCAATCAAGGGCAAAGCATAATGATGGACCTATTTGAAACAAATTCCTATTTTTTTTACCTGGATGGAGATAATGGAGCCTTTCAACAACTGGGAGTAGCAGATGGATCCCCTGTCTACCCAGGTAGTGAGGGGACATTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAAGAGGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGTCCTGGACAATGTCTAATCTGGGCCTGCAAGACCTGCAAAAGAAAGTCTGCCCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGGAGAAGGCTAAAGAAGATCAATGAAGCTTTTGAGGCTCTCAAAAGAAGGACTGTGGCAAACCCAAACCAAAGACTTCCCAAAGTTGAAATACTACGCAGTGCCATTAATTATATCGAAAGGCTCCAGGATCTGTTGCACAGTTTGGATCAGCAGGACAAGCCACAGAAAGCAGATGAGGAACCCTTCTCCTATAACCCCAAAGAGGCTTCTATTCAGAGTGAGGATTTCTTAAGTACCTGTCATCCTGAGTGGCACCATATTCCCGACCATTCCAGAATGCCCGATCTCAATATTAAAGAAGAAAGATCCCTACAGGAGAATTCCTCCTCCAGCAGCCTGC
                                                  Xl3.1-CHK-1012713643                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGCTGTTTTGAGCACGCCACTTAGCTAGGCTGCCAGAGCAATCAAGGGCAAAGCATAATGATGGACCTATTTGAAACAAATTCCTATTTTTTTTACCTGGATGGAGATAATGGAGCCTTTCAACAACTGGGAGTAGCAGATGGATCCCCTGTCTACCCAGGTAGTGAGGGGACATTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAAGAGGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGTCCTGGACAATGTCTAATCTGGGCCTGCAAGACCTGCAAAAGAAAGTCTGCCCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGGAGAAGGCTAAAGAAGATCAATGAAGCTTTTGAGGCTCTCAAAAGAAGGACTGTGGCAAACCCAAACCAAAGACTTCCCAAAGTTGAAATACTACGCAGTGCCATTAATTATATCGAAAGGCTCCAGGATCTGTTGCACAGTTTGGATCAGCAGGACAAGCCACAGAAAGCAGATGAGGAACCCTTCTCCTATAACCCCAAAGAGGCTTCTATTCAGAGTGAGGATTTCTTAAGTACCTGTCATCCTGAGTGGCACCATATTCCCGACCATTCCAGAATGCCCGATCTCAATATTAAAGAAGAAAGATCCCTACAGGAGAATTCCTCCTCCAGCAGCCTGCAGTGCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      65     110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN      62      97                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR      65     232                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG      65       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-018     NP_001021893.1 Helix Loop Helix family member (hlh-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 4e-029     NP_001093596.1 MyoD-family protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-030     XP_001178452.1 PREDICTED: similar to Transcription factor SUM-1 (Sea urchin myogenic factor 1) [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 6e-031     NP_476650.1 nautilus CG10250-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = ?? ==== 4e-039     XP_001790150.1 PREDICTED: myogenin (myogenic factor 4) [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 3e-069     NP_001003982.1 myogenic factor 6 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 7e-081     XP_854303.1 PREDICTED: similar to Myogenic factor 6 (Myf-6) [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 5e-090     NP_032683.1 myogenic factor 6 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 4e-090     NP_002460.1 myogenic factor 6 (herculin); Myogenic factor-6 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bt ==== 3e-091     NP_861527.1 myogenic factor 6 (herculin); myogenic factor 6, transcription activator [Bostaurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 5e-094     NP_001025917.1 myogenic factor 6 (herculin) [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 3e-121     AAI53697.1 Myogenic factor 6 (herculin) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Xl ==== 5e-125     NP_001088572.1 hypothetical protein LOC495450 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3200585-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAG---------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2      seed Tbd2 5g                IMAGE:3200585-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGGCTGTGCTGTTTTGAGCACGCCACTTAGCTAGGCTGCCAGAGCAATCAAGGGCAAAGCATAATGATGGACCTATTTGAAACAAATTCCTAttttttttACCTGGATGGAGATAATGGAGCCTTTCAACAACTGGGAGTAGCAGATGGATCCCCTGTCTACCCAGGTAGTGAGGGGACATTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAAGAGGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGTCCTGGACAATGTCTAATCTGGGCCTGCAAGACCTGCAAAAGAAAGTCTGCCCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGGAGAAGGCTAAAGAAGATCAATGAAGCTTTTGAGGCTCTCAAAAGAAGGACTGTGGCAAACCCAAACCAAAGACTTCCCAAAGTTGAAATACTACGCAGTGCCATTAATTATATCGAAAGGCTCCAGGATCTGTTGCACAGTTTGGATCAGCAGGACAAGCCACAGAAAGCAGATGAGGAACCCTTCTCCTATAACCCCAAAGAGGCTTCTATTCAGAGTGAGGATTTCTTAAGTACCTGTCATCCTGAGTGGCACCATATTCCCGACCATTCCAGAATGCCCGATCTCAATATTAAAGAAGAAAGATCCCTACAGGAGAATTCCTCCTCCAGCAGCCTGCAGTG
  5   1   2       bld Tad2 5g                         IMAGE:6933441.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAGCACGCCACTTAGCTAGGCTGCCAGAGCAATCAAGGGCAAAGCATAATGATGGACCTATTTGAAACAAATTCCTAttttttttACCTGGATGGAGATAATGGAGCCTTTCAACAACTGGGAGTAGCAGATGGATCCCCTGTCTACCCAGGTAGTGAGGGGACATTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAAGAGGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGTCCTGGACAATGTCTAATCTGGGCCTGCAAGACCTGCAAAAGAAAGTCTGCCCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGGAGAAGGCTAAAGAAGATCAATGAAGCTTTTGAGGCTCTCAAAAGAAGGACTGTGGCAAACCCAAACCAAAGACTTCCCAAAGTTGAAATACTACGCAGTGCCATTAATTATATCGAAAGGCTCCAGGATCTGTTGCACAGTTTGGATCAGCANGACAACCACAGAAGCAATAGACTCACAGTAGACCGTCAGAAAN
  5   1   2       bld Tbd6                   IMAGE:4437244-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGTCTACCCAGGTAGTGAGGGGACATTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAAGAGGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGTCCTGGACAATGTCTAATCTGGGCCTGCAAGACCTGCAAAAGAAAGTCTGCCCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGGAGAAGGCTAAAGAAGATCAATGAAGCTTTTGAGGCTCTCAAAAGAAGGACTGTGGCAAACCCAAACCAAAGACTTCCCAAAGTTGAAATACTACGCAGTGCCATTAATTATATCGAAAGGCTCCAGGATCTGTTGCACAGTTTGGATCAGCAGGACAAGCCACAGAAAGCAGATGAGGAACCCTTCTCCTATAACCCCAAAGAGGCTTCTATTCAGAGTGAGGATTTCTTAAGTACCTGTCATCCTGAGTGGCACCATATTCCCGACCATTCCAGAATGCCCGATCTCAATATTAAAGAAGAAAGATCCCTACAGGAGAATTCCTCCTCCAGCAGCCTGCAGTGCCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)