Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012788597 Xl3.1-XL456o20ex.5 - 4 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL456o20ex.5                GAGGAACTGATAGTAGTGGGCCAATACCAACATGTGGAGAGGACAAACACAGGCTGGGACAAAAAACACTACAAGTACTCCAGAGTCGGAACTTTCTCCTTACAGTTGGCTATTACCTTGAAAAAGCCTGGAAACAAGTTGGAGAAGAAAGGGACATGAGGAGAGTAATAGTTCTGCCTGGGATGTTGTGCACTGGAGAGTAACAAGGGGCTGCCTTGCAACAGGAAACACGGCACCAGGCTGCCTGGGATGCCTTCATGTAAACAAAAGAGATTAAATATTTAGCAAAATATGACTGAGGACATCATGGCCACTTCCTACCCTACTTTCCTTACAACCCCCTACCTGCCGATGAATTTGTTGATGAATTTAACCAATGACACCGAGGACATTTGTGTTTTTGACGAGGGATTTAAGTTTTTGCTGCTGCCGGTCTCCTACAGTGCAGTGTTTATGGTGGGCCTGCCTCTGAACATAGCCGCTATGTGGATATTCATTGCCAAAATGCGCCCATGGAACCCTACAACAGTTTATATGTTTAACCTTGCACTGTCGGACACATTGTACGTTCTGTCTCTGCCCACGTTGGTCTATTACTATGCTGACAAAAACAACTGGCCCTTTGGGGAAGTTCTTTGCAAGCTTGTGAGATTCCTCTTTTATGCCAATCTCTATTCCAGCATTCTGTTCCTCACCTGCATCAGTGTGCACCGATACCGGGGAGTGTGCCACCCTATAACCTCTCTGAGGCGTATGAACGCTAAACACGCCCTATGTGATCTGTGNCTTTGGTATGGCTATCCGTAACACTCTGCC------------ATATTTNTCACAGTCAGCCCAAAG------------TTGCCATGATAC
                                                  Xl3.1-CHK-1012706814                      CTGATAGTAGTGGGCCAATACCAACATGTGGAGAGGACAAACACAGGCTGGGACAAAAAACACTACAAGTACTCCAGAGTCGGAACTTTCTCCTTACAGTTGGCTATTACCTTGAAAAAGCCTGGAAACAAGTTGGAGAAGAAAGGGACATGAGGAGAGTAATAGTTCTGCCTGGGATGTTGTGCACTGGAGAGTAACAAGGGGCTGCCTTGCAACAGGAAACACGGCAxxxxxCTGCCTGGGATGxxxTxxTGTAAACAAAAGAGATTAAATATTTAGCAAAATATGACTGAGGACATCATGGCCACTTCCTACCCTACTTTCCTTACAACCCCCTACCTGCCGATGAATTTGTTGATGAATTTAACCAATGACACCGAGGACATTTGTGTTTTTGACGAGGGATTTAAGTTTTTGCTGCTGCCGGTCTCCTACAGTGCAGTGTTTATGGTGGGCCTGCCTCTGAACATAGCCGCTATGTGGATATTCATTGCCAAAATGCGCCCATGGAACCCTACAACAGTTTATATGTTTAACCTTGCACTGTCGGACACATTGTACGTTCTGTCTCTGCCCACGTTGGTCTATTACTATGCTGACAAAAACAACTGGCCCTTTGGGGAAGTTCTTTGCAAGCTTGTGAGATTCCTCTTTTATGCCAATCTCTATTCCAGCATTCTGTTCCTCACCTGCATCAGTGTGCACCGATACCGGGGAGTGTGCCACCCTATAACCTCTCTGAGGCGTATGAACGCTAAACACGCCxxxxxxxNxxxxxxTCTTTGGTATGGCTATCCGTAACACTxxxxxNTCCCCAATTTNATATTTNTCACAGTCAGCCCAAAGNCAAAA
                                                      consensus depths                     1     1     1     1     1     2     2     2     2     2     2     2     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     1     2     1     2     1     2     1     2     1     2     0     1     1     1     1     1     0     1     1     1
                                               BLH ATG     291     365                
                                               BLH MIN     291      60                
                                               BLH OVR     291     208                
                                               ORF LNG     291       4                
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 1e-008     AAP91736.1 kappa opioid receptor-like [Ciona intestinalis] ------------------------------==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 7e-011     XP_001192329.1 PREDICTED: similar to GA20661-PA [Strongylocentrotus purpuratus] ------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-012     NP_493666.2 K10B4.4 [Caenorhabditis elegans] -----------------------------========================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-012     NP_001027135.1 CG13702-PC, isoform C [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 3e-040     XP_542321.2 PREDICTED: similar to P2Y purinoceptor 2 (P2Y2) (P2U purinoceptor 1) (P2U1) (ATP receptor) (Purinergic receptor) [Canis familiaris] ==========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 2e-043     XP_425667.2 PREDICTED: similar to purinergic receptor [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 1e-046     NP_065646.1 purinergic receptor P2Y, G-protein coupled, 4; P2Y4 receptor [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 5e-047     XP_592537.1 PREDICTED: similar to uridine nucleotide receptor [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 8e-048     NP_002556.1 pyrimidinergic receptor P2Y4; P2Y purinoceptor 4; uridine nucleotide receptor[Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 1e-051     XP_001336663.1 PREDICTED: similar to pyrimidinergic receptor P2Y, G-protein coupled, 4-like [Danio rerio] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 3e-074     NP_001025633.1 MGC97549 protein [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 7e-093     AAI57737.1 P2ry4 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL456o20ex.5                                                                                                                                                                            TGA------TAATAG------------------------------------------------------------------------------ATG------------------------------TAG------ATG------------ATG------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------ATG---------------------------ATG------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA---------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Em10                            IMAGE:8321083.5p                GAGGAACTGATAGTAGTGGGCCAATACCAACATGTGGAGAGGACAAACACAGGCTGGGACAAAAAACACTACAAGTACTCCAGAGTCGGAACTTTCTCCTTACAGTTGGCTATTACCTTGAAAAAGCCTGGAAACAAGTTGGAGAAGAAAGGGACATGAGGAGAGTAATAGTTCTGCCTGGGATGTTGTGCACTGGAGAGTAACAAGGGGCTGCCTTGCAACAGGAAACACGGCACCAGGGATAATGCAACTCCTTCATGTAAACAAAAGAGATTAAATATTTAGCAAAATATGACTGAGGACATCATGGCCACTTCCTACCCTACTTTCCTTACAACCCCCTACCTGCCGATGAATTTGTTGATGAATTTAACCAATGACACCGAGGACATTTGTGTTTTTGACGAGGGATTTAAGTTTTTGCTGCTGCCGGTCTCCTACAGTGCAGTGTTTATGGTGGGCCTGCCTCTGAACATAGCCGCTATGTGGATATTCATTGCCAAAATGCGCCCATGGAACCCTACAACAGTTTATATGTTTAACCTTGCACTGTCGGACACATTGTACGTTCTGTCTCTGCCCACCTTGGTCTATTACTATGCTGACAAATACAACTGGCCCTTTTGGGGAAGTTCTTTGCAAGCTTGTGAGATT
  5   1   2       bld Ga15                               XL456o20ex.5p                              GTGGGCCAATACCAACATGCTGGAGAGGACAAACACAGGCTGGGACAAAAAACACTACAAGTACTCCAGAGTCGGAACTTTCTCCTTACAGTTGGCTATTACCTTGAAAAAGCCTGGAAACAAGTTGGAGAAGAAAGGGACATGAGGAGAGTAATAGTTCTGCCTGGGATGTTGTGCACTGGAGAGTAACAAGGGGCTGCCTTGCAACAGGAAACACGGCACCAGGTATAATACAACTCCTTCATGTAAACAAAAGAGATTAAATATTTAGCAAAATATGACTGAGGACATCATGGCCACTTCCTACCCTACTTTCCTTACAACCCCCTACCTGCCGATGAATTTGTTGATGAATTTAACCAATGACACCGAGGACATTTGTGTTTTTGACGAGGGATTTAAGTTTTTGCTGCTGCCGGTCTCCTACAGTGCAGTGTTTATGGTGGGCCTGCCTCTGAACATAGCCGCTATGTGGATATTCATTGCCAAAATGCGCCCATGGAACCCTACAACAGTTTATATGTTTAACCTTGCACTGTCGGACACATTGTACGTTCTGTCTCTGCCCACGTTGGTCTATTACTATGCTGACAAAAACAACTGGCCCTTTGGGGAAGTTCTTTGCAAGCTTGTGAGATTCCTCTTTTATGCCAATCTCTATTCCAGCATTCTGTTCCTCACCTGCATCAGTGTGCACCGATACCGGGGAGTGTGCCACCCTATAACCTCTCTGAGGCGTATGAACGCTAAACACGCCCTATGTGATCTGTGNCTTTGGTATGGCTATCCGTAACACTCTGCCTT
  5   1   2      seed Emb4 5g                IMAGE:5541804-IMAGp.IMAGp                                                                                 CAGAGGAACTGATAGTAGTGGGCCAATACCAACATGTGGAGAGGACAAACACAGGCTGGGACAAAAAACACTACAAGTACTCCAGAGTCGGAACTTTCTCCTTACAGTTGGCTATTACCTTGAAAAAGCCTGGAAACAAGTTGGAGAAGAAAGGGACATGAGGAGAGTAATAGTTCTGCCTGGGATGTTGTGCACTGGAGAGTAACAAGGGGCTGCCTTGCAACAGATGACTGAGGACATCATGGCCACTTCCTACCCTACTTTCCTTACAACCCCCTACCTGCCGATGAATTTGTTGATGAATTTAACCAATGACACCGAGGACATTTGTGTTTTTGACGAGGGATTTAAGTTTTTGCTGCTGCCGGTCTCCTACAGTGCAGTGTTTATGGTGGGCCTGCCTCTGAACATAGCCGCTATGTGGATATTCATTGCCAAAATGCGCCCATGGAACCCTACAACAGTTTATATGTTTAACCTTGCACTGTCGGACACATTGTACGTTCTGTCTCTGCCCACCTTGGTCTATTACTATGCTGACAAAAACAACTGGCCCTTTGGGGAAGTTCTTTGCAAGCTTGTGAGATTCCTCTTTTATGCCAATCTCTATTCCAGCATTCTGTTCCTCACCTGCATCAGTGTGCACCGATACCGGGGAGTGTGCCACCC
  5   1   2       bld Ga18 5g                           xlk122l10ex.5p                                                                                            ATAGTAGTGGGNCAATACCAACATGTGGAGAGGACAAACACAGGCTGGGACAAAAAACACTACAAGTACTCCAGAGTCGGAACTTTCTCCTTACAGTTGGCTATTACCTTGAAAAAGCCTGGAAACAAGTTGGAGAAGAAAGGGACATGAGGAGAGTAATAGTTCTGCCTGGGATGTTGTGCACTGGAGAGTAACAAGGGGCTGCCTTGCAACAGATGACTGAGGACATCATGGCCACTTCCTACCCTACTTTCCTTACAACCCCCTACCTGCCGATGAATTTGTTGATGAATTTAACCAATGACACCGAGGACATTTGTGTTTTTGACGAGGGATTTAAGTTTTTGCTGCTGCCGGTCTCCTACAGTGCAGTGTTTATGGTGGGCCTGCCTCTGAACATAGCCGCTATGTGGATATTCATTGCCAAAATGCGCCCATGGAACCCTACAACAGTTTATATGTTTAACCTTGCACTGTCGGACACATTGTACGTTCTGTCTCTGCCCACGTTGGTCTATTACTATGCTGACAAAAACAACTGGCCCTTTGGGNNAGNTCTTTGCAAGCTTGTGAGATTCCTCTTTTATGCCAATCTCTATTCCAGCATTCTGTTCCTCACCTGCATCAGTGTGCACCGATACCGGGGAGNGTGCCACCCTATAACCTCTCTGANGCGTATGAACNNTAAACACGCCTATGTGANCTGTGCTTTGGNNTGGCTATCCGNANNACTCTGCCTTNTCCCCAATTTNATATTTNTCACAGTCAGCCCAAAGNCAAAAANNNCATTGCCATGATACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)