Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-XL086g07.3                            4 END     2          33       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8532794.5                       7 PI      87        142      688                hypothetical protein LOC100036910 [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012788817 Xl3.1-IMAGE:6636417.5 - 6 ESTs
                                                                       ......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6636417.5                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAAAACAGCAAAGAGGGAACGGAGCAGCCTCTCCTGTACTGTCTGCTTTAGTCTCTGGGTCACCCCCATCCAACCACTCCATTTATCCAGCCATCCATCCTCGGTCGTGTAGCAACCCCTGCGTTTGGATCAGATCGGGTTTTGGTAGCCAAGATGGAAGAATCCCAGAATGGTGTAAAATACGGAGGAGATGCAACAGATGCAAAAGAATATTTTACAATTCAACCACGAAGCCTGCAAAACTGTGACCTAAAAGACATAGAAAGAAAAACTAAGTTTGCTCATCTCCAGAATTACAGAACAAATTACCCAGAGATGGGAATGTGCCTCATCATTAACAATAAGAACTTTCATTCATCAAACATGGCCGTACGAAATGGAACTGATGTAGATGCTCTCAAGTTACATGAAACTTTCACAGGTTTAGGATACGAGGTAATGATTTACAATGATCAAAAGTCTAGTGACATCATTGGACGTTTGAAGAAAATATCTGAGGAAGATCACAGCAAGAGAAGTTCCTTTGTATGTGCTATTCTGAGCCATGGAGAGGAGGATGGTTCGATCTGTGGAGTTGATGTTCCTATACATATAAAAAATCTAACAGATCTTTTCAGAGGAGACCGATGCAAGACTCTTGTGGGCAAACCCAAAATATTCTTCATCCAGGCATGCAGGGGAACAGAGCTTGATTCAGGCATTGAAACAGACAGTTGCAGTGAACCACGGGAAGAGATCCAGC
                                                  Xl3.1-CHK-1012700970                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGCAAAGAGGGAACGGAGCAGCCTCTCCTGTACTGTCTGCTTTAGTCTCTGGGTCACCCCCATCCAACCACTCCATTTATCCAGCCATCCATCCTCGGTCGTGTAGCAACCCCTGCGTTTGGATCAGATCGGGTTTTGGTAGCCAAGATGGAAGAATCCCAGAATGGTGTAAAATACGGAGGAGATGCAACAGATGCAAAAGAATATTTTACAATTCAACCACGAAGCCTGCAAAACTGTGACCTAAAAGACATAGAAAGAAAAACTAAGTTTGCTCATCTCCAGAATTACAGAACAAATTACCCAGAGATGGGAATGTGCCTCATCATTAACAATAAGAACTTTCATTCATCAAACATGGCCGTACGAAATGGAACTGATGTAGATGCTCTCAAGTTACATGAAACTTTCACAGGTTTAGGATACGAGGTAATGATTTACAATGATCAAAAGTCTAGTGACATCATTGGACGTTTGAAGAAAATATCTGAGGAAGATCACAGCAAGAGAAGTTCCTTTGTATGTGCTATTCTGAGCCATGGAGAGGAGGATGGTTCGATCTGTGGAGTTGATGTTCCTATACATATAAAAAATCTAACAGATCTTTTCAGAGGAGACCGATGCAAGACTCTTGTGGGCAAACCCAAAATATTCTTCATCCAGGCATGCAGGGGAACAGAGCTTGATTCAGGCATTGAAACAGACAGTTGCAGTGAACCACGGGAAGAGATCCAGCGTATTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                            3     3     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     6     3     6     3     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     2     4     2     4     2     4     2     3     2     3
                                               BLH ATG     155     513                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH MIN     155      69                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH OVR     155     835                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               ORF LNG     155      20                                                                                                                                                                                                                                                                                                                                                                                                                       
                                                                       PROTEIN --- Ce ---- 1e-016     NP_502538.1 cell death protein, Caspase, ICE-like apoptotic protease., CEll Deathabnormality CED-3 (56.6 kD) (ced-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 6e-023     NP_477462.1 CG14902-PA [Drosophila melanogaster] ----------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 5e-024     AAP91733.1 caspase-1-like [Ciona intestinalis] ------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Ag ==== 3e-027     XP_320580.3 caspase short class (AGAP011952-PA) [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 3e-029     XP_001203516.1 PREDICTED: similar to caspase-3, partial [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 9e-038     XP_604643.3 PREDICTED: similar to caspase 7 [Bos taurus] -----------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 1e-044     NP_001041531.1 hypothetical protein LOC566604 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Cf ==== 1e-045     NP_001003042.1 caspase-3 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---= 9e-046     NP_033940.1 caspase 3, apoptosis related cysteine protease [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bt ==== 5e-046     NP_001071308.1 caspase 3 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 9e-047     NP_004337.2 caspase 3 preproprotein [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 3e-047     NP_990056.1 caspase-3 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 6e-085     NP_001120900.1 caspase 3, apoptosis-related cysteine peptidase [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 7e-112     NP_001081225.1 xcpp32 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6636417.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------ATG------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       bld Oo1  5g                         IMAGE:6861967.5p                                                                                                                                                                                   AGAATTCTGCTACCGATTGGCAAGAGGGCGCGGCGTCATCAGTTGCTTAGTTAAAGGCTCTGCCTATTAGTCTCTGTTTATAGGTTCCCCTGCGTTTGTGCTGGTAGGAGATTGGCTCGCTCTCAACCAATTAAGCTGTGTTTCTGGTGCAAGTCCCCGCCCTATTTTTTCTCCTTATTATTTAGTGTAAGGTCTGTGCTGCTGCTGTTTTCGAAAATCACGAAAGACACAAAAACAGCAAAGAGGGAACGGAGCAGCCTCTCCTGTACTGTCTGCTTTAGTCTCTGGGTCACCCCCATCCAACCACTCCATTTATCCAGCCATCCATCCTCGGTCGTGTAGCAACCCCTGCGTTTGGATCAGATCGGGTTTTGGTAGCCAAGATGGAAGAATCCCAGAATGGTGTAAAATACGGAGGAGATGCAACAGATGCAAAAGAATATTTTACAATTCAACCACGAAGCCTGCAAAACTGTGACCTAAAAGACATAGAAAGAAAAACTAAGTTTGCTCATCTCCAGAATTACAGAACAAATTACCCAGAGATGGGAATGTGCCTCATCATTAACAATAAGAACTTTCATTCATCAAACATGGCCGTACGAAATGGAACTGATGTAGATGCTCTCAAGTTACATGAAACTTTCACAGGTTTAGGATACGAGGTAATGGTTTGCAATGATCAAAAGTCTAGTGACATCATTGGACGTTTGAAGAAAATATCTGAGGAAGATCACAGCAAGAGAAGTTCCTTTGTATGTGCTATTCTGAGCCATGGAGAGGAGGATGGTTCGATCTGTGGAGTTGATGGTCCCTATACGTATAAAAAAATCTAAACAGATCTTTTTCAGAAGGAGACCCGATGCAAAGAACTCTTTGTGG
  5   1   2       add Emb1 5g                         IMAGE:6636417.5p                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGGGTCTGCGCTGCTGCTGTTTTCGAAAATCACGAAAGACAAAAAACAGCAAAGAGGGAACGGAGCAGCCTCTCCTGTACTGTCTGCTTTAGTCTCTGGGTCACCCCCATCCAACCACTCCATTTATCCAGCCATCCATCCTCCGTCGTGCAGCAACCCCTGCGTTTGGATCAGATCAGGTTTTGGTAGCCAAGATGGAAGAATCCCAGAATGGTGTAAAATACGGAGGAGATGCAACAGATGCAAAAGAATATTTTACAATTCAACCACGAAGCCTGCAAAACTGTGACCTAAAAGACATAGAAAGAAAAACCAAGTTTGCTCATCTCCAGAAATACAGAACAAATTACCCAGAGATGGGAATGTGCCTCATCATTAACAATAAGAACTTTCATTCATCAGAGATGGCCGTACGAAATGGAACTGATGTAGATGCTCTCAAGTTACATGAAACTTTCACAGGTTTAGGATACGAGGTAATGATTTACAATGATCAAAAGTCTAGTGACATCTTTGGACGTTTGAAGAAAATATCTGAGGAAGATCACAGCAAGAGAAGTTCCTTTGTATGTGCTATTCTGAGCCATGGAGAGGAGGATGGTTCGATCTGTGGAGTTGATGTTCCTATACATATAAAAAATCTAACAGATCTTTTCAGAGGAGACCGATGCAAGACTCTTGTGGGCNAACCCAAAATATTCTTCATCCAGGCATGCAGGGGAACAGAGCTTGATTCANGCATTGAAACAGACAGTTGCAGTGAACCACGGGAAGAGATCCAGCGTATTCCCGTGGGAGGGCGGACTTCTTATATTGCCTATTTCTACTGTCCCCCGGGCTACCTAACTCATGGNAGAGGACACCAATGAATGGGGTTCCCTGGGTTCCATCCCAAGCCTTTTTGTGCCGAAAATG
  5   1   2       add Emb1 5g                         IMAGE:5157221.5p                                                                                                                                                                                                                                                                                                                                                                                                                    AGACAAAAAACAGCAAAGAGGGAACGGAGCAGCCTCTCCTGTACTGTCTGCTTTAGTCTCTGGGTCACCCCCATCCAACCACTCCATTTATCCAGCCATCCATCCTCCGTCGTGCAGCAACCCCTGCGTTTGGATCAGATCAGGTTTTGGTAGCCAAGATGGAAGAATCCCAGAATGGTGTAAAATACGGAGGAGATGCAACAGATGCAAAAGAATATTTTACAATTCAACCACGAAGCCTGCAAAACTGTGACCTAAAAGACATAGAAAGAAAAACCAAGTTTGCTCATCTCCAGAAATACAGAACAAATTACCCAGAGATGGGAATGTGCCTCATCATTAACAATAAGAACTTTCATTCATCAGAGATGGCCGTACGAAATGGAACTGATGTAGATGCTCTCAAGTTACATGAAACTTTCACAGGTTTAGGATACGAGGTAATGATTTACAATGATCAAAAGTCTAGGGACATTCTTTGGACGTTTTGAAAGAAAAATATCTGAGGGAAGATCCCCAGCAAGAAAAAGTTCCCTTTGGAATGGGGCCAATTCCGGAACCCATGGAAAAGGGAGGAATGGGGTTCCCATCCTGGGGGAAGCTTGGAATGGTCCCCTTTTCCCTTTTTTaaaaaaaatcctaaaccgaaatcccttttttccaaaaaGGAAAAACCCCGAATGGCCAAGGAAACTCTCTTTGGGGGGGGGGCCAAAAACCCCCCCaaaaaaaaaaaaTTTTCTT
  5   1   2      seed Oo1  5g                         IMAGE:5084306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGAGGGAACGGAGCAGCCTCTCCTGTACTGTCTGCTTTAGTCTCTGGGTCACCCCCATCCAACCACTCCATTTATCCAGCCATCCATCCTCGGTCGTGTAGCAACCCCTGCGTTTGGATCAGATCGGGTTTTGGTAGCCAAGATGGAAGAATCCCAGAATGGTGTAAAATACGGAGGAGATGCAACAGATGCAAAAGAATATTTTACAATTCAACCACGAAGCCTGCAAAACTGTGACCTAAAAGACATAGAAAGAAAAACTAAGTTTGCTCATCTCCAGAATTACAGAACAAATTACCCAGAGATGGGAATGTGCCTCATCATTAACAATAAGAACTTTCATTCATCAAACATGGCCGTACGAAATGGAACTGATGTAGATGCTCTCAAGTTACATGAAACTTTCACAGGTTTAGGATACGAGGTAATGGTTTGCAATGATCAAAAGTCTAGTGACATCATTGGACGTTTGAAGAAAATATCTGAGGAAGATCACAGCAAGAGAAGTTCCTTTGTATGTGCTATTCTGAGCCATGGAGAGGAGGATGGTTCGATCTGTGGAGTTGATGTTCCTATACATATAAAAAATCTAACAGATCTTTTCAGAGGAGACCGATGCAAGACTCTTGTGGGCAAACCCAAAATATTCTTCATCCAGGCATGCAGGGGGAACAGAGCTTGATTCAGGCATTGAAACAGACAGTTGCAGTGAACCACGGGGAGAGATCCAGCGTATTCCAGTGGAGGCCGACTTCTTATATGCCTATTCTACTGTTCCCCGGCTACTGCTCATGGAGAGACAAAATGGATGGGTTCCTGGTTCCATCCAGTCTTTTGTG
  5   1   2       bld Tbd7 5g3  out                        XL086g07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCCTCTCCTGTACTGTGCTGCTTTAGTACTCTGGGTCACCCCCATCCAACCACTCCATTTATCCAGCCATCCATCCTCGGTCGTGTAGCAACCCCTGCGTTTGGATCAGATCGGGTTTTGGTAGCCAAGATGGAAGAATCCCAGAATGGTGTAAAATACGGAGGAGATGCAACAGATGCAAAAGAATATTTTACAATTCAACCACGAAGCCTGCAAAACTGTGACCTAAAAGACATAGAAAGAAAAACTAAGTTTGCTCATCTCCAGAATTACAGAACAAATTACCCAGAGATGGGAATGTGCCTCATCATTAACAATAAGAACTTTCATTCATCAAACATGGCCGTACGAAATGGAACTGATGTAGATGCTCTAAGTTACATGAAACTTTCACAGGTTTAGGATACGAGGTAATGGTTTGCAATGATCAAAAGTCTAGTGACATCATTGGACGTTTGAAGAAAATATCTGAGGAAGATCACAGCAAGAGAAGTTCCTTTGTATGTGCTATTCTGAGCCATGGAGAGGAGGATGGTTCGATCTGTGGAGTTGATGTTCCTATACATATNA
  5   1   1       add Ov1       out                   IMAGE:5048733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ccacgcgtccgcggacgcgtgggcggacgcgtgggGAAAATATCTGAGGAAGATCACAGCAAGAGAAGTTCCTTTGTATGTGCTATTCTGAGCCATGGAGAGGAGGATGGTTCGATCTGTGGAGTTGATGTTCCTATACATATAAAAAATCTAACAGATCTTTTCAGAGGAGACCGATGCAAGACTCTTGTGGGCAAACCCAAAATATTCTTCATCCAGGCATGCAGGGGAACAGAGCTTGATTCAGGCATTGAAACAGACAGTTGCAGTGAACCACGGGAAGAGATCCAGCGTATTCCAGTGGAGGCCGACTTCTTATATGCCTATTCTACTGTCCCCGGCTACTACTCATGGAGAGACACAATGAATGGTTCCTGGTTCATCCAGTCTTTGTGCGAAATGATAAAATTATATGGATCACATCTTGAACTTATTCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGACTTTGAGACTTGTACAAATCTGGTAACTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAATCATTTTACTTCTTTAAGTAAAGAGAGGAATTAAAGTGATACTGACACTAAAAAATGAATTTTAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)