Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk147l17ex.3                        35 END     2          66        5                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk147l17ex.3                        35 PI      92        656      840                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012788972 Xl3.1-xlk123f17ex.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk123f17ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAACATATAATCCACTATGAGACAACTGGGCCAGCCCTCTGCACCTTGGTCTTCCTTCTCATCTACTTCT------------CTCCATCTGGTGGGTCATTCTCTCCCTCACCTGGTTCCTGGCCGCTGGNTGAAATGGGGCAACGAGGCTATCGCTGGCTACTCACAGTATTTCCACTTGGCCGCCTGGTTGGTGCCCAGTATCAAATCCATCCGCTGTCTGGCCCTCAGCTCCGTGGATGGAGACCCGGTGGCTGGCATCTGCTTTGTGGGCAACCAGAACCTGGACAACCTGCGGGGGTTTGTGTTGGCCCCGTTAGTCATCTACCTGTTCATCGGCAGCATGTTCCTCCTGGCCGGATTTGTCTCCCTCTTTAGGATCCGCAGTGTCATCAAACAAGGGGGCACCAAGACGGACAAACTGGAAAAACTCATGATCCGGATTGGGATATTCAGCGTCTTGTACACGGTGCCGGCTACCATAGTGGTGGCTTGTTTCTTCTACGAACAGCACAACCGCCAGGTTGGGAGGTGGCCCATAACTGTAACTCGTGCCAGTCTGAGGGGGCACAGCCTCGCCGGCCGGACTACGCGGTTTTCATGCTCAAGTACTTTATGTGCCTGGTGGTGGGCATCACGTCGGGCGTGTGGATCTGGTCCTTTAAAGTAATAAGAATGTGGTACCGTGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTNGNCCTTTAAAACACTTTAATTTTTTAAATGCCCTTATTCCTTTAAGACTCCCAGGGTGAGG
                                                  Xl3.1-CHK-1012714869                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATATAATCCACTATGAGACAACTGGGCCAGCCCTCTGCACCTTGGTCTTCCTTCTCATCTACTTCTTTGGCA------------CTGGTGGGTCATTCTCTCCCTCACCTGGTTCCTGGCCGCTGGNTGAAATGGGGCAACGAGGCTATCGCTGGCTACTCACAGTATTTCCACTTGGCCGCCTGGTTGGTGCCCAGTATCAAATCCATCxxxxxNNTGGCCCTCAGCTCCGTGGATGGAGACCCGGTGGCTGGCATCTGCTTTGTGGGCAACCAGAACCTGGACAACCTGCGGGGGTTTGTGTTGGCCCCGTTAGTCATCTACCTGTTCATCGGCAGCATGTTCCTCCTGGCCGGATTTGTCTCCCTCTTTAGGATCCGCAGTGTCATCAAACAAGGGGGCACCAAGACGGACAAACTGGAAAAACTCATGATCCGGATTGGGATATTCAGCGTCTTGTACACGGTGCCGGCTACCATAGTGGTGGCTTGTTTCTTCTACGAACAGCACAACCGCCAGGTTGGGAGGTGGCCCATAACTGTAACTCGTGCCAGTCTGAGGGGGCACAGCCTCGCCGGCCGGACTACGCGGTTTTCATGCTCAAGTACTTTATGTGCCTGGTGGTGGGCATCACGTCGGGCGTGTGGATCTGGTCCTTTAAAGTAATAAGAATGTGGTACCGTGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTxxxxTGGNxxxTAAAACACTTTAAxxxxxxAAATGCxxxTxTTCCTTTAAGACTCCCAGGGTGAGGTTTGNA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     0     1     2     2     2     2     2     2     1     2     1     2     2     2     2     2     2     3     2     3     2     3     2     3     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     2     3     2     3     3     3     3     3     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1
                                               BLH MIN     135     109                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                 PROTEIN --- Ce ---- 3e-032     NP_503964.2 Caenorhabditis FriZzled homolog family member (cfz-2) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PREDICTED - Sp ---- 4e-058     XP_001186596.1 PREDICTED: similar to frizzled 4 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-066     XP_311505.1 ENSANGP00000024916 [Anopheles gambiae str. PEST] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-067     NP_001027713.1 frizzled receptor [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-068     NP_001097643.1 frizzled 2 CG9739-PC, isoform C [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                         PREDICTED - ?? ---- 3e-071     XP_874144.3 PREDICTED: similar to frizzled 8 protein; Xfz8 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                        PREDICTED - Cf ---- 2e-073     XP_545614.2 PREDICTED: similar to frizzled 5 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                        PREDICTED - Bt ---- 1e-073     XP_580981.1 PREDICTED: similar to seven-transmembrane receptor Frizzled-5 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-073     NP_032084.1 frizzled homolog 8 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-073     NP_114072.1 frizzled 8 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                          PREDICTED - Gg ---- 7e-085     XP_426568.2 PREDICTED: similar to frizzled-5 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN --- Xt ---- 2e-078     NP_001090860.1 frizzled homolog 8 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PROTEIN --- Dr ---- 2e-096     NP_570993.2 frizzled homolog 8a [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                   PROTEIN --- Xl ---- 4e-110     NP_001084206.1 frizzled-8 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk123f17ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAA------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA------------------------------TAA---------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                           ...
  5   1   1       add Ga18                              xlk124n13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAACATATAATCCACTATGAGACAACTGGGCCAGCCCTCTGCACCTTGGTCTTCCTTCTCATCTACTTCTTTGGCATGGCNNCTCCATCTGGTGGGTCATTCTCTCCCTCACCTGGTTCCTGGCCGCNNNNNGAAATGGGGCAACGAGGCTATCGCTGGCTACTCACAGTATTTCCACTTGGCCGCCTGGTTGGTGCCCAGTATCAAATCCATCGCTGTNNTGGCCCTCAGCTCCGTGGATGGAGACCCGGTGGCTGGCATCTGCTTTGTGGGCAACCAGAACCTGGACAACCTGCGGGGGTTTGTGTTGGCCCCGTTAGTCATCTACCTGTTCATCGGCAGCATGTTCCTCCTGGCCGGATTTGTCTCCCTCTTTAGGATCCGCAGTGTCATCAAACAAGGGGNCACCAAGACGGACAAACTGGAAAAACTCATGATCCGGATTGGGATATTCAGCGTCTTGTACACAGTGCCGNCTACCATAGTGGTGGCTTGTTTCTTCTACGAACAGCACAACCGCCAGGTTGGGAGNNGGCCCATAACTGTAACTCGTGCCAGTCTGAGGGGGCACANCCTCGCCGGNCGGACTACGCGGTTTTCATGCTCAAGNACTTTNTGT
  5   1   2       bld Ga18      out                      xlk56f05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCTCCATCTGGTGGGTCATTCTCTCCCTCACCTGGTTCCTGGCCGCTGGNTGAAATGGGGCAACGAGGCTATCGCTGGCTACTCACAGTATTTCCACTTGGCCGCCTGGTTGGTGCCCAGTATCAAATCCATCGCTGTNNTGGCCCTCAGCTCCGTGGATGGAGACCCGGTGGCTGGCATCTGCTTTGTGGGCAACCAGAACCTGGACAACCTGCGGGGGTTTGTGTTGGCCCCGTTAGTCATCTACCTGTTCATCGGCAGCATGTTCCTCCTGGCCGGATTTGTCTCCCTCTTTAGGATCCGCAGTGTCATCAAACAAGGGGGCACCAAGACGGACAAACTGGAAAAACTCATGATCCGGATTGGGATATTCAGCGTCTTGTACACGGTGCCGGCTACCATAGTGGTGGCTTGTTTCTTCTACGAACAGCACAACCGCCAGGTTGGGAGGTGGCCCATAACTGTAACTCGTGCCAGTCTGAGGGGGCACAGNCTCNNCGGCCGGACTACGCGGNTTTCATGCTCAAGTACTTTATGTGCCTGGTGGTGGGCATCACGTCGGGCGTGTGGATCTGGTCAGGGAAGANTTTGGAATCGTGGAGGGNANTCTGTACCCGCTGCTGTTGGGNNAGTAAAACCACCGGCGGGTCAATGTACAGCGACGNCAGCACCGGGCTGANCTGGNGNNCTGCAACTGGNAGCTCTGTGTCTTNCCCAAAACAAATGCCCTTATCTCAGG
  5   1   2      seed Ga18      out                     xlk123f17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTACTCACAGTATTTCCACTTGGCCGCCTGGTTGGTGCCCAGTATCAAATCCATCGCTGTCTGGCCCTCAGCTCCGTGGATGGAGACCCGGTGGCTGGCATCTGCTTTGTGGGCAACCAGAACCTGGACAACCTGCGGGGGTTTGTGTTGGCCCCGTTAGTCATCTACCTGTTCATCGGCAGCATGTTCCTCCTGGCCGGATTTGTCTCCCTCTTTAGGATCCGCAGTGTCATCAAACAAGGGGGCACCAAGACGGACAAACTGGAAAAACTCATGATCCGGATTGGGATATTCAGCGTCTTGTACACGGTGCCGGCTACCATAGTGGTGGCTTGTTTCTTCTACGAACAGCACAACCGCCAGGTTGGGAGGTGGNCCATAACTGTAACTCGTGCCAGTCTGAGGGGGCACAGCCTCGCCGGCCGGACTACGCGGTTTTCATGCTCAAGTACTTTATGTGCCTGGTGGTGGGCATCACGTCGGGCGTGTGGATCTGGTCCTTTAAAGTAATAAGAATGTGGTACCGTGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTNGNCCTTTAAAACACTTTAATTTTTTTGGNGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGNAAGCGGNTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)