Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:8538056.5                       4 END     1          20       25                PREDICTED: similar to synapsin II isoform IIb [Canis familiaris]
     2   1.5    0Xl3.1-IMAGE:4743204.3                       3 END     2          40       66                (no blast hit)

 This cluster: approximate FL confidence score = 82%

 1012789538 Xl3.1-IMAGE:4957303-IMAGp.5 - 5 ESTs
                                                                       ........-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4957303-IMAGp.5                                                                                                                       GGAATTCCTGGCGGTACCAATTGTCGGCGCTAAGTGCCTGAGGAGTAGACGGAGTGAGGAGAATCCCCCGCTGCCATTGATCTCTCACAGCATCGCCGGTACCGGAGCAGGGTCCCATGATGAATTACCTGCGGCGCCGCCTGTCGGACAGTAACTTCATGGCCAACCTGCCCAATGGCTATATGAGCGACCTGCAGCGCCCGGACCCGCCCGCCCCTCCGCCCCCGGGACCCCAGGGGCCCCCTCCTCCCGCCGCCCCTCCTCCCGCCGCCGTCTCCCCCGAACCCCCCAGCTCTGGCGGCTTCTTCTCTTCCCTTTCTAACGCCGTGAAACAGACCACCGCGGCCCTCAGCGAGCAGGTCTCCACCGCCACCGGGGGCGGCCCTGGCCTCAAGGGCAGCAAAGTCCTCCTCGTCATCGATGAACCGCACAGACGCAGGGGGAAGCTGTTTAAGGGGAAGAGAATCAATGGAGAATACGATATCAAAGTGGAACAGGCCGAGTTCTGTGACCTGAATCTGGTGGCACACAGTAATGGCAGCTTCTCTGTAGACCTGGAGGTTCTGAGGAATGGGGTGAAGGTTGTAAGGTCATTGAAGCCAGACTTTGTGCTGATTCGCCAGCACGCCTTCAGCATGGCACGTAACGGGGACTTCCGCAGCTTGGTCATTGGGCTGCAGTATGCTGGGGTGCCCAGCCTCAACTCCCTGCATTCTGTCTACAACTTCTGTGACAAACCTTGGGTGTTCTCCCAGTTGGTGCGATTACACAAGAAGCTGGGGCCGGAGGAGTTCCCTCTCATTGAGCAAACCTATTACCCCAACCATAAGGAGATGCTGACTGCATCCAAGTTCCCCGTTGTGATCAAAATGGGACACGCACATTCGGGGATGGGGAAGGTGAAGGTGGACAATCAGTATGATTTCCAGGACATAGCGAGTGTGGTGGCGCTGACCAAGACTTACGCCACATCGGAGCCGTTCATAGACGCCAGTCCCAGTCCCCTCAGAGGCAGTCAAGTCCACAAGGCCCCCAGTCACCTCAAAGGCAACAGCAAGGCCCACCTATGCCAACTGGCCCCAAGCCAATGGGAGTTCAACCTGGGCAGCCACGGCAGCCGGCTCCTCCAAGACAGCCAATCCCTGCAGGGCCCCAGCAGAAGCCGGCCCCTCCACT
                                                  Xl3.1-CHK-1012703488                                                                                                                             CCTGGCGGTACCAATTGTCGGCGCTAAGTGCCTGAGGAGTAGACGGAGTGAGGAGAATCCCCCGCTGCCATTGATCTCTCACAGCATCGCCGGTACCGGAGCAGGGTCCCATGATGAATTACCTGCGGCGCCGCCTGTCGGACAGTAACTTCATGGCCAACCTGCCCAATGGCTATATGAGCGACCTGCAGCGCCCGGACCCGCCCGCCCCTCCGCCCCCGGGACCCCAGGGGCCCCCTCCTCCCGCCGCCCCTCCTCCCGCCGCCGTCTCCCCCGAACCCCCCAGCTCTGGCGGCTTCTTCTCTTCCCTTTCTAACGCCGTGAAACAGACCACCGCGGCCCTCAGCGAGCAGGTCTCCACCGCCACCGGGGGCGGCCCTGGCCTCAAGGGCAGCAAAGTCCTCCTCGTCATCGATGAACxxxAxxGACGCAGGGGGAAGCTGTTTAAGGGGAAGAGAATCAATGGAGAATACGATATCAAAGTGGAACAGGCCGAGTTCTGTGACCTGAATCTGGTGGCACACAGTAATGGCAGCTTCTCTGTAGACCTGGAGGTTCTGAGGAATGGGGTGAAGGTTGTAAGGTCATTGAAGCCAGACTTTGTGCTGATTCGCCAGCACGCCTTCAGCATGGCACGTAACGGGGACTTCCGCAGCTTGGTCATTGGGCTGCAGTATGCTGGGGTGCCCAGCCTCAACTCCCTGCATTCTGTCTACAACTTCTGTGACAAACCTTGGGTGTTCTCCCAGTTGGTGCGATTACACAAGAAGCTGGGGCCGGAGGAGTTCCCTCTCATTGAGCAAACCTATTACCCCAACCATAAGGAGATGCTGACTGCATCCAAGTTCCCCGTTGTGATCAAAATGGGACACGCACATTCGGGGATGGGGAAGGTGAAGGTGGACAATCAGTATGATTTCCAGGACATAGCGAGTGTGGTGGCGCTGACCAAGACTTACGCCACATCGGAGCCGTTCATAGACGCCAGTCCCAGTCCCCTCAGAGGCAGTCAAGTCCACAAGGCCCCCAGTCACCTCAAAGGCAACAGCAAGGCCCACCTATGCCAACTGGCCCCAAGCCAATGGGAGTTCAACCTGGGCAGCCACGGCAGCCGGCTCCTCCAAGACAGCCAATCCCTGCAGGGCCCCAGCAGAAGCCGGCCCCTCCACTCAGCCA
                                                      consensus depths                                                                                                                            2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     116     164                                                                                                                       
                                               BLH MIN     116     120                                                                                                                       
                                               BLH OVR     116     191                                                                                                                       
                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 5e-046     XP_001195845.1 PREDICTED: similar to synapsin isoform 11.1 [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Ag ---- 5e-050     XP_553315.3 AGAP003318-PA [Anopheles gambiae str. PEST] ---------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 2e-056     NP_731459.2 Synapsin CG3985-PD, isoform D [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 9e-097     XP_001790130.1 PREDICTED: similar to synapsin III, isoform IIIa (predicted) isoform 1 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 8e-098     XP_541766.2 PREDICTED: similar to synapsin II isoform IIb [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PREDICTED = Dr ==== 1e-116     NP_001119909.1 hypothetical protein LOC570672 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 1e-128     NP_001104250.1 synapsin I isoform b [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN === Bt ==== 3e-129     NP_776616.1 synapsin I [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 7e-130     NP_008881.2 synapsin I isoform Ia [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PREDICTED = Xt ==== 1e-159     NP_001121423.1 hypothetical protein LOC100158514 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 1e-166     NP_001087750.1 MGC84302 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4957303-IMAGp.5                                                                                                                                                             TGA------------------------------------TGA------------------------------------ATGATG------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------ATG
                                                                   ORF                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                               ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   1       add Eye1 5g                         IMAGE:4743481.5p                                                                                                                   AGGGGGAATTCCTGGCGGTACCAATTGTCGGCGCTAAGTGCCTGAGGAGTAGACGGAGTGAGGAGAATCCCCCGCTGCCATTGATCTCTCACAGCATCGCCGGTACCGGAGCAGGGTCCCATGATGAATTACCTGCGGCGCCGCCTGTCGGACAGTAACTTCATGGCCAACCTGCCCAATGGCTATATGAGCGACCTGCAGcgcccggacccgcccgcccctccgnccccgggaccccnggggccccccncnnccgccgccccnncncccgccgccgcnggccccgncccccccggccgCGGCGGG
  5   1   2       bld Eye1      out                   IMAGE:6957158.5p                                                                                                                       GGAATTCCTGGCGGTACCAATTGTCGGCGCTAAGTGCCTGAGGAGTAGACGGAGTGAGGAGAATCCCCCGCTGCCATTGATCTCTCACAGCATCGCCGGTACCGGAGCAGGGTCCCATGATGAATTACCTGCGGCGCCGCCTGTCGGACAGTAACTTCATGGCCAACCTGCCCAATGGCTATATGAGCGACCTGCAGcgcccggacccgcccgcccctccgcccccgggaccccaggggccccctcctcccgccgcccctcctcccgccgccgtctcccccgaaccccCCAGCTCTGGCGGCTTCTTCTCTTCCCTTTCTAACGCCGTGAAACAGACCACCGCGGCCCTCAGCGAGCAGGTCTCCACCGCCACCGGGGGCGGCCCTGGCCTCAAGGGCAGCAAAGTCCTCCTCGTCATCGATGAACCGCACAGCGACTGGGGGAAGCTGTTTAAGGGGAAGAGAGTCAGTGGAGAATACGATATCAAAGTGGAACAGGCTGAGTTCTGTGACCTGAATCTGGTGGCGCACAGTAATGGCAGCTTTTCTGTGGACCTGGAGGTTCTGAGGAATGGGGTGAAGGTTGTGAGGTCATTGAAGCCAGACTTTGTGCTGATTCGCCAGCACGCCTTCAGCATGGCACGGAACGGAGACTTCCGCAGCTTGGTCATTGGGCTGCAGTATGCTGGGGTGCCCAGCCTTAACTCCCTGCATTCTGTCTACAACTTCTGTGACAAACCTTTGGGTGTTCTCCCAGTTGGTGCGATTACACAAAGAAACTGGGGCCCGGAGGAATTCCCTTCTCCATTGAGCAAACCTTATTTACCCCCAACTTTTAAGGGAAAATGCTTCACCCGCAATCCAAAAGTTCCCCGGGGGCCCGGC
  5   1   2      seed Emb4                   IMAGE:4957303-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAAGGGACGCAGGGGGAAGCTGTTTAAGGGGAAGAGAATCAATGGAGAATACGATATCAAAGTGGAACAGGCCGAGTTCTGTGACCTGAATCTGGTGGCACACAGTAATGGCAGCTTCTCTGTAGACCTGGAGGTTCTGAGGAATGGGGTGAAGGTTGTAAGGTCATTGAAGCCAGACTTTGTGCTGATTCGCCAGCACGCCTTCAGCATGGCACGTAACGGGGACTTCCGCAGCTTGGTCATTGGGCTGCAGTATGCTGGGGTGCCCAGCCTCAACTCCCTGCATTCTGTCTACAACTTCTGTGACAAACCTTGGGTGTTCTCCCAGTTGGTGCGATTACACAAGAAGCTGGGGCCGGAGGAGTTCCCTCTCATTGAGCAAACCTATTACCCCAACCATAAGGAGATGCTGACTGCATCCAAGTTCCCCGTTGTGATCAAAATGGGACACGCACATTCGGGGATGGGGAAGGTGAAGGTGGACAATCAGTATGATTTCCAGGACATAGCGAGTGTGGTGGCGCTGACCAAGACTTACGCCACATCGGAGCCGTTCATAGACGCCAGTCCCAGTCCCCTCAGAGGCAGTCAAGTCCACAAGGCCCCCAGTCACCTCAAAGGCAACAGCAAGGCCCACCTATGCCAACTGGCCCCAAGCCAATGGGAGTTCAACCTGGGCAGCCACGGCAGCCGGCTCCTCCAAGACAGCCAATCTCTGCAGGGCCCCAGCAGAAGCCGGCCCCTCCACTCAGCCAACA
  5   1   2       bld Emb4      out                   IMAGE:4957303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGGGACGCAGGGGGAAGCTGTTTAAGGGGAAGAGAATCAATGGAGAATACGATATCAAAGTGGAACAGGCCGAGTTCTGTGACCTGAATCTGGTGGCACACAGTAATGGCAGCTTCTCTGTAGACCTGGAGGTTCTGAGGAATGGGGTGAAGGTTGTAAGGTCATTGAAGCCAGACTTTGTGCTGATTCGCCAGCACGCCTTCAGCATGGCACGTAACGGGGACTTCCGCAGCTTGGTCATTGGGCTGCAGTATGCTGGGGTGCCCAGCCTCAACTCCCTGCATTCTGTCTACAACTTCTGTGACAAACCTTGGGTGTTCTCCCAGTTGGTGCGATTACACAAGAAGCTGGGGCCGGAGGAGTTCCCTCTCATTGAGCAAACCTATTACCCCAACCATAAGGAGATGCTGACTGCATCCAAGTTCCCCGTTGTGATCAAAATGGGACACGCACATTCGGGGATGGGGAAGGTGAAGGTGGACAATCAGTATGATTTCCAGGACATAGCGAGTGTGGTGGCGCTGACCAAGACTTACGCCACATCGGAGCCGTTCATAGACGCC
  5   1   1       add Eye1      out                   IMAGE:4743204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGCGCCAGGGGCCACCCCCCCAGCAACGACCCCCACCACAGGTCAACAGGTCCAGGGTCTAAGTCCTCAGCCTTCTGCACATCCACCAAATCTACCCAGTCCAGGAGCCCAGCAACGCCAAATCCCCCCTCAAcagcagccccagcaggtccgaccccagcagcagccttcaccccgccagtcccagTCCCCTCAGAGGCAGTCAAGTCCACAAGGCCCCCAGTCACCTCAAAGGCAACAGCAAGGCCCACCTATGCCAACTGGCCCCAAGCCAATGGGAGTTCAACCTGGGCAGCCACGGCAGCCGGCTCCTCCAAGACAGCCAATCCCTGCAGGGCCCCAGCAGAAGCCGGCCCCTCCACTCAGCCAACAGCAGCAGCAGCCCCCACAACAGGGCACCCGCCAGCCAATGCAGCAGCCGCCACTTCAGCAGCGCCAGTCTGTTCCTGGAGCGCCGCAACAGCCGCCACCCCGACCAATGACTCAGCAGCCCCGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)