Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6317522.5                       4 PI      92          1      761                embryonic poly(A) binding protein 2 [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:7205509.5                       4 PI      90          1      921                embryonic poly(A) binding protein 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012789633 Xl3.1-IMAGE:6631670.5 - 5 ESTs
                                                                       ....-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6631670.5                                                                                                                                                                                                                                                                         TGTGGGAAAACCACATTCTTTTGCCTTCCCTGTGGGATGAGACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCTGAAGAATGTGAATTGGACGATCCTGAATTGAAAGCCATCAGAATGCGAGTGCGAGAAATGGAGGAGGAGGCAGAGCGGCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTTAGCCCCAGGCCCTGCATGAAACTGATTCATTCGAAGATGACAGCAGGAGAATATACTGAGGGTCCTCCTCTACCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGCAACGTGGATTACGGAGGTACAGCCCAGGATCTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAACCGCATCACTATTTTATGTGACAAATTCTCCGGGCATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTAGATGCTGCAGTGACAATGGATGAAACCGTATTCCGAGGACGAACAATTAAGGTTCTACCCAAGAGAACAAACATGCCAGGAATTAGCACCACGGACAGGGGTGGATTCCGTGGCAGACCTCGAGGAAACAGAGGCAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGCCCTTTGAATCACCCATACTGAATGAGAAGAGCCCTGTAGCACTACCAACTCTCTGTGCACATCATATACCTAACATGCTACATCATGCCTTAATCTGCCACCTGGGAATGCCTTCCGTACGTCTGGCCAAAGAAATTTGCTTTAATATTGTGAAAAACCCAGATGGCACCAAGAGGATGTTTTGGGAATTTTGTGCTACTAAACTACAGCATGTCAATAGCTCTGTTCTATAAAAGCC
                                                  Xl3.1-CHK-1012704417                                                                                                                                                                                                                                                                               AAAACCACATTCTTTTGCCTTCCCTGTGGGATGAGACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCTGAAGAATGTGAATTGGACGATCCTGAATTGAAAGCCATCAGAATGCGAGTGCGAGAAATGGAGGAGGAGGCAGAGCGGCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTTAGCCCCAGGCCCTGCATGAAACTGATTCATTCGAAGATGACAGCAGGAGAATATACTGAGGGTCCTCCTCTACCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGCAACGTGGATTACGGAGGTACAGCCCAGGATCTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAACCGCATCACTATTTTATGTGACAAATTCTCCGGGCATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTAGATGCTGCAGTGACAATGGATGAAACCGTATTCCGAGGACGAACAATTAAGGTTCTACCCAAGAGAACAAACATGCCAGGAATTAGCACCACGGACAGGGGTGGATTCCGTGGCAGACCTCGAGGAAACAGAGGCAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGCCCTTTGAATCACCCATACTGAATGAGAAGAGCCCTGTAGCACTACCAACTCTCTGTGCACATCATATACCTAACATGCTACATCATGCCTTAATCTGCCACCTGGGAATGCCTTCCGTACGTCTGGCCAAAGAAATTTGCTTTAATATTGTGAAAAACCCAGATGGCACCAAGAGGATGTTTTGGGAATTTTGTGCTACTAAACTACAGCATGTCAATAGCTCTGTTCTATA
                                                      consensus depths                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     4     4     3     4     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN      35      89                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ==== 2e-012     NP_001027768.1 glycine rich RNA binding protein [Ciona intestinalis] ================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 2e-043     NP_492504.1 poly binding protein II like (22.6 kD) (1J998) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ag ---- 8e-047     XP_313998.3 AGAP005117-PA [Anopheles gambiae str. PEST] ---------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 7e-047     NP_724648.1 CG2163-PB [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 8e-048     XP_799120.1 PREDICTED: similar to polyadenylate-binding protein nuclear 1 [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 4e-055     XP_001232211.1 PREDICTED: similar to Pabpn1-prov protein [Gallus gallus] ----------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                          PROTEIN --- Bt ---- 1e-057     NP_776994.1 poly(A) binding protein, nuclear 1 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                         PREDICTED - Dr ---- 8e-058     NP_001098602.1 hypothetical protein LOC794679 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                          PROTEIN --- Cf ---- 9e-059     NP_001123909.1 poly(A) binding protein, nuclear 1 [Canis lupus familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN --- Mm ---- 9e-059     NP_062275.1 poly(A) binding protein, nuclear 1; poly(A) binding protein II [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                          PROTEIN --- Hs ---- 8e-059     NP_004634.1 poly(A)-binding protein, nuclear 1; poly(A) binding protein II; oculopharyngealmuscular dystrophy; poly(A) binding protein 2 [Homo sapiens] ---------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 3e-121     AAI21547.1 Poly(A) binding protein, nuclear 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Xl ==== 1e-124     NP_001082505.1 putative polyA-binding protein PABPN2/ePABP2 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6631670.5                                                                                                                                                                                                                                                                                                                           ATG------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------TGAATG------------TAG---------------------------------------------ATG---TAA---------------------------------------------------------TGA---------ATG---------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   1       add Ooc1      in                      xlnoc003g23.5p TTGTGTCCACGTTGCACTTTGGGTGCAAACCATCAAAAGACTCCTGCACAGAGATACAGAAAACTATATTCTATGGAGTGGGTGTTTAAACAGTTTTGGAAAGAACAGAGTTAACATATAAGTCACCTCTGGTCAAGCAGGGATCCCTGTTAGCCTTGGCAAACAAAGGGTTATTGAAGGACTGGGCCAAAAGTATTGCTGTGCTGTCTCTTGGGCATTAGCATTTCTTGGGAGAGTCACACCAGGTGTGGATTAAAAACAGGGTGTGGGAAAACCACATTCTTTTGCCTTCCCTGTGGGATGAGACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCTGAAGAATGTGAATTGGACGATCCTGAATTGAAAGCCATCAGAATGCGAGTGCGAGAAATGGAGGAGGAGGCAGAGCGGCTGAAGGNGTTATCTGGACAGGATAAGAGTATTGGTGTTAGCCCCAGGCCCTGCATGANACTGATTCATTCGAAGATGACAGCAGGAGAATATNACTGGGGTCCTNCTCTACCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGGTTATGTTGGCAACGTGGATTAAGGAGGTACAGCNCCAAGATCTAGAAGCTCACTTCAGTAGCTGTGGTTCATCAACCGCATCAACTAATTATGTGACANATTCTTCCGGCATTCCAAAGGATATGCCTAATTATGAGTTGCAGAAAAGGACTCTGTG
  5   1   2       bld Egg1                               PBX0143C08.5p                                                                                                                                                                                                                                                             ATTAAAACAAGGTGTGGGAAAACCACATTCTTTTGCCTTCCCTGTGGGATGAGACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCTGAAGAATGTGAATTGGACGATCCTGAATTGAAAGCCATCAGAATGCGAGTGCGAGAAATGGAGGAGGAGGCAGAGCGGCTGAAGGGGTTATCTGGACAGGATAAGAGTATAGGTGTTAGCCCCAGGCCCTGCATGAAACTGATTCATTCGAAGATGACAGCAGGAGAATATACTGAGGGTCCTCCTCTACCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGCAACGTGGATTACGGAGGTACAGCCCAGGATCTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAACCGCATCACTATTTTATGTGAGCAACGTGGATTACGGAGGTACAGCCCAGGATCTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAACCGCATCACTATTTTATGTGACAAATTCT
  5   1   2      seed Emb1                            IMAGE:6631670.5p                                                                                                                                                                                                                                                                    CAAGGTGTGGGAAAACCACATTCTTTTGCCTTCCCTGTGGGATGAGACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCTGAAGAATGTGAATTGGATGATCCTGAATTGAAAGCCATCAGAATGCGAGTGCGAGAAATGGAGGAGGAGGCAGAACGGCTGAAGGGGTTATCTGGACAGGATAAGAATATTGGTGTTAGCCCCAGGCCCTGCATGAAACTGATTCATTCGAAGATGACAGCAGGAGAATATACTGAGGGTCCTCCTCGACCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGCAACGTGGATTACGGAGGTACAGCCCAGGATCTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAACCGCATCACTATTTTATGTGACAAATTCTCCGGGCATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTAGATGCTGCAGTGACAATGGATGAAACCGTATTCCGAGGACGAACAATTAAGGTTCTACCCAAGAGAACAAACATGCCAGGAATTAGCACCACGGACAGGGGTGGATTCCGTGGCAGACCTCGAGGAAACAGAGGCAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGCCCTTTGAAATCACCATACTGAATGAGAAGAGCCCTGTAGCACTACCAACTCTCTGTGCACATCATATACCCTAACATGGCTTCATCATGCCCTTAATCTGCCCACCTGGGGGATGCCTTTCCCGTATGGCCTGGGCCC
  5   1   1       add Egg1                               PBX0035E12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGTCCTCCTCTACCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGCAACGTGGATTACGGAGGTACAGCCCAGGATCTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAACCGCATCACTATTTTATGTGACAAATTCTCCGGGCATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTAGATGCTGCAGTGACAATGGATGAAACCGTATTCCGAGGACGAACAATTAAGGTTCTACCCAAGAGAACAAACATGCCAGGAATTAGCACCACGGACAGGGGTGGATTCCGTGGCAGACCTCGAGGAAACAGAGGCAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGCCCTTTGAATCACCCATACTGAATGAGAAGAGCACTGTAGCACTACCAACTCTCTGTGCACATCATATACCTAACATGCTACATCATGCCTTAATCTGCCACCTGNGGATGCCTTCCGTACGTCTGGCCAAAGAAATTTGCTTTAATATTGTGAAAAACCCAGATGGCACCAAGAGGATGTTTTGGGAATTTTGTGCTACTAAACTACAGCATGTCAATAGCTCTGTTCTATAAAAGCCTATTT
  3   1   1       add Ooc1      in                      xlnoc003g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATATGTACAAATCTCCGGGCATCAAGAGGATATACATATATTAAGTTGCAAGACAGAAACTCTGTAGATGCTGCAGTGGCAATGGATACAACCGTATTCCGAGAACAATCAATTAAGGTTCTACGCAAGAGAACAGACATGCCAGGAATTAGCACCACGGACAGGGGTGAATTCCGTGGCAGACCTCGAGGAAACAGAGGCAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGTGTAAGACCAGGCCCTTTGAATCACCCATACTGAATGAGAAGAGCCCTGTAGCACTACCAACTCTCTGTGCACATCATATACCTAACATGCTACATCATGCCTTAATCTGCCACCTGGGAATGCCTTCCGTACGTCTGGCCAAAGAAATTTGCTTTAATATTGTGAAAAACCCAGATGGCACCAAGAGGATGTTTTGGGAATTTTGTGCTACTAAACTACAGCATGTCAATAGCTCTGTTCTATAAAAGCCTATTTAATGTTTACTTATTGTATTGCATTACGTTGGTTACTAAAATAAACAATTGTCGTGCTTTCAGGCCTTGTGAAAAGAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)