Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6316672-IMAGp.5                12 END     2          33       16                hypothetical protein LOC734574 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6631944.5                       3 PI      86          1      268                (no blast hit)
     3   0.0    0Xl3.1-XL479n05ex.5                          3 PI      82        374      883                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012789661 Xl3.1-xl241j19.3 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl241j19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACCGGTGGCAGAATAACAAGAGGCAAGACTTCCGGCAGCTGCTTATGGGAGTGGCTGACAAAAACATCCAGTACTATGAAAAGTGCCTTACAGCCTGGGAGTCCATTATACCACTGCTACAAGACAAACAGGAACCAAAGTAAGCATTCCTTAAATGAAAGGACACTGCACCATGTTGTGAGTTTGCTAGGGCTGACACCAGCTGTAGAACTTACAAACCCAATGACTGTAGACTGCATTGATCTTTTTAACACGGTGCATTCTATGAAACCCACAGATTTCCTATTTTGTTTCTACACTCTGAGGTTTTTTTCTTTTGTTTGCCTCTTGTAAAGGCACCAAGGACTCACAAATTGGTTTGGTCTTCAGCTCCACCAGCAACAACATTTCTTGTGATCTGTAAAAAAAGAGCCTTCACTTTATATGACAAACATGCATACCATCTGAAGTTTCATAACACTAAACTCACATCAACTATTGTGAAGAACCTGTTGAGTGCAATTAAAACATGTCATTATGATGCCATATTACTCTGAGTGGATTTCCAGAAAGACCCGTTTTTTTTATACGGTTTATCTCCACTATCTGTGGCCAACTTTTTTCCTGTGTACATCTGACTAGGGATCCAATTTTTTATGTGCGCGTGTGTGCAGTCCAAATTTTACCTCTGAATGTTTATAGGAGCGTCTGGTCAGCATGAACTTTATTGGTAAACGTGGCATGAAGTAATCCCTGTTTGATGTTCTTTTTGCCATCCCCAAAATTGGAATGCAGTCTGTTGTACCTCTGCACATGGAGCCAGGTCTTGGGTATTATTTTTGTTTACACTGGGGCCTTATATGAAGTCTATCAAAGGGAACATCAGTCAGAGACATTTTTGGGGGT
                                                  Xl3.1-CHK-1012701981                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGGCAGAATAACAAGAGGCAAGACTTCCGGCAGCTGCTTATGGGAGTGGCTGACAAAAACATCCAGTACTATGAAAAGTGCCTTACAGCCTGGGAGTCCATTATACCACTGCTACAAGACAAACAGGAACCAAAGTAAGCATTCCTTAAATGAAAGGACACTGCACCATGTTGTGAGTTTGCTAGGGCTGACACCAGCTGTAGAACTTACAAACCCAATGACTGTAGACTGCATTGATCTTTTTAACACGGTGCATTCTATGAAACCCACAGATTTCCTATTTTGTTTCTACACTCTGAGGTTTTTTTCTTTTGTTTGCCTCTTGTAAAGGCACCAAGGACTCACAAATTGGTTTGGTCTTCAGCTCCACCAGCAACAACATTTCTTGTGATCTGTAAAAAAAGAGCCTTCACTTTATATGACAAACATGCATACCATCTGAAGTTTCATAACACTAAACTCACATCAACTATTGTGAAGAACCTGTTGAGTGCAATTAAAACATGTCATTATGATGCCATATTACTCTGAGTGGATTTCCAGAAAGACCCGTTTTTTTTATACGGTTTATCTCCACTATCTGTGGCCAACTTTTTTCCTGTGTACATNTGACTAGGGATCCAATTTTTTATGTGCGCGTGTGTGCAGTCCAAATTTTACCTCTGAATGTTTATAGGAGCGTCTGGTCAGCATGAACTTTATTGGTAAACGNGGCATGAAGTAATCCCTGTTTGATGTTCTTTTTGCCATCCCCAAAATTGGAATGCAGTCTGTTGTACCTCTGCACATGGAGCCAGGTCTTGGGTATTATTTTTGTTTACACTGGGGCCTTATATGAAGTCTATCAAAGGGAACATCAGTCAGAGACATTTTTGGGGGTTTTCTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     6     6     5     6     6     6     6     6     6     6     6     6     6     6     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     3     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                       ...PREDICTED - Mm ---- 8e-018     NP_766056.1 RIKEN cDNA 4732481H14 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 2e-018     XP_538794.2 PREDICTED: similar to sorting nexin 7 (predicted) [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-019     NP_001017798.1 hypothetical protein LOC550496 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-019     NP_001013012.1 sorting nexin family member 30 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 1e-019     XP_873315.1 PREDICTED: similar to sorting nexin family member 30 [Bos taurus] ================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 4e-020     XP_424910.2 PREDICTED: similar to sorting nexin family member 30 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 7e-022     AAI53330.1 Sorting nexin family member 30 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 3e-022     NP_001089520.1 hypothetical protein LOC734574 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                      Xl3.1-xl241j19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------TAA------------TGA---------------------------------------------------------------------------------TGA------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------TGA------------------ATG------------------------------TGAATG------------------------------------TAA------------------------TGA---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                         ]
  5   1   2      seed Ga12      in                         XL195e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGCTGCTGCCTTGAAAAGAGAAGAGCGATCTACGGTGCCAACGGATGTAGAGAAGTGCCAGGATAAGGTAGAATGTTTTAATGCAGATCTGAAAGCGGACATGGACCGGTGGCAGAATAACAAGAGGCAAGACTTCCGGCAGCTGCTTATGGGAGTGGCTGACAAAAACATCCAGTACTATGAAAAGTGCCTTACAGCCTGGGAGTCCATTATACCACTGCTACAAGACAAACAGGAACCAAAGTAAGCATTCCTTAAATGAAAGGACACTGCACCATGTTGTGAGTTTGCTAGGGCTGACACCAGCTGTAGAACTTACAAACCCAATGACTGTAGACTGCATTGATCTTTTTAACACGGTGCATTCTATGAAACCCACAGATTTCCTATTTTGTTTCTACACTCTGAGGtttttttcttttGTTTGCCTCTTGTAAAGGCACCAAGGACTCACAAATTGGTTTGGTCTTCAGCTCCACCAGCAACAACATTTCTTGTGATCTGTAAAAAAAGAGCCTTCACTTTATATGACAAACATGCATACCATCTGAAGTTTCATAACACTAAACTCACATCAAC
  5   1   2       bld Egg1                               PBX0163H01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGAGGCGGACATGGACCGGTGGCAGAATAACAAGAGGCAAGACTTCCGGCAGCTGCTTATGGGAGTGGCTGACAAAAACATCCAGTACTATGAAAAGTGCCTTACAGCCTGAGAGTCCATTATACCACTGCTACAAGACAAACAGGAACCAAAGTAAGCATTCCTTAAATGAAAGGACACTGCACCATGTTGTGAGTTTGCTAGGGCTGACACCAGCTGTAGAACTTACAAACCCAATGACTGTAGACTGCATTGATCTTTTTAACACGGTGCATTCTATGAAACCCACAGATTTCCTATTTTGTTTCTACACTCTGAGGtttttttcttttGTTTGCCTCTTGTAAAGGCACCAAGGACTCACAAATTGGTTTGGTCTTCAGCTCCACCAGCAACAACATTTCTTGTGATCTGTAAAAAAAGAGCCTTCACTTTATATGACAAACATGCATACCATCTGAAGTTTCATAACACTAAACTCACA
  5   1   2       bld DMZ                                  xl257d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAAAGTAAGCATTCCTTAANTGAAAGGACACTGCACCATGATTGTGAGTTTGCTAGGGCTGACACCAGCTGTAGAACTTACNAACCCAATGACTGTANACTGCATTGATCTTTTTAACACGGTGCATTCTACGAAACCCACAGATTTCCTATTTTGTTTCTACACTCTGAGGtttttttcttttGNTTGCCTCTTGTAAAGGCACCANGGACTCACAAATTGGTTTGGTCTTCAGCTCCACCAGCAACAACATTTCTTGTGATCTGTAAAAAAAGAGCCTTCACTTTATATGACAAACATGCATACCATCTGAAGTTTCATAACACTAAACTCACATCAACTATTGTGAAGAACCTGTTGAGTGCAATTAAAACATGTCATTATGATGCCATATTACTCTGAGTGGATTTCCAGAAAGACCCGttttttttATACGGTTTATCTCCACTATCTGTGGCCAACTTTTTTCCTGTGTACATCTGACTAGGGATCCAATTTTTTATGTGCGCGTGTGTGCAGTCCAAATTTTACCTCTGAATGTTTATAGGAGCGTCTGGTCAGCATGAACTTTATTGGTAAACGTGG
  3   1   2       bld DMZ  5g3  out                        xl241j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGGTTTTTTTCTTTNGTTTGCCTCTTGTAAAGGCACCAAGGACTCACAAATTGGTTTGGTCTTCAGCTCCACCAGCAACAACATTTCTTGTGATCTGTAAAAAAAGAGCCTTCACTTTATATGACAAACATGCATACCATCTGAAGTTTCATAACACTAAACTCACATCAACTATTGTGAAGAACCTGNTGAGTGCAATTAAAACATGTCATTATGATGCCATATTACTCTGAGTGGATTTCCAGAAAGACCCGTTTTTTTTATACGGTTTATCTCCACTATNTGTGGCCAACTTTTTTCCTGNGTACATCTGACTAGGGATCCAATTTTTTATGTGCGCGTGTGTGCAGTCCAAATTTTACCTCTGAATGTTTATAGGAGCGTCTGGTCAGCATGAACTTTATTGGTAAACGNGGCATGAAGTAATCCCTGTTTGATGTTCTTTTTGCCATCCCCAAAATTGGAATGCAGTCTGTTGTACCTCTGCACATGGAGCCAGGTCTTGGGTATTATTTTTGTTTACACTGGGGCCTTATATGAAGTCTATCAAAGGGAACATCAGTCAGAGACATTTTTGGGGGTTTTCTTGAAAATAAGNTCCAAAAGGAAATTAAAATAC
  3   1   2       add Ga12 5g3  out                        XL192f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCNCCAGCAACAACATTTCTTGTGATNTGTAAAAAAAGAGCCTTCACTTTATATGACAAACATGCATNCCATNTGAAGTTTCATAACACTAAACTCACATCAACTATTGTGAAGAACCTGTTGAGTGCAATTAAAACATGTCATTATGATGCCATATTACTTTGAGTGGATTTCCAGAAAGACCCGTTTTTTTTATACGGTTTATCTCCACTATCTGTGGCCAACTTTTTTCCTGTGTACATNTGACTAGGGATCCAATTTTTTATGTGCGCGNGTGTGCAGTCCAAATTTTACCTTTGAATGTTTATAGGAGCGTCTGGTCAGCATGAACTTTATTGGTAAACGNGGCATGAAGTAATCCCTGTTTGATGTTNTTTTTGCCATCCCCAAAATTGGAATGCAGTCTGTTGTACCTNTGCACATGGAGCCAGGTCTTGGGTATTATTTTTGTTTACACTGGGGCCTTATANGAAGTCTATCAAAGGGAACATCAGTCAGAGACATTTTTGGGGGTTTTCTGAAAATAAGTTCCAAAAGGAAATTTAAAATACA
  3   1   2       add Ga12      in                         XL195e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACAACATTTCTTGNGATCTGTAAAAAAAGAGCCTTCNCTTTATATGACAAACATGCATACCATNTGAAGTTTCATAACACTAAACTCACATCAANTATTGTGAAGAACCTGTTGAGTGCAATTAAAACATGTCATTATGATGCCATATTNCTTTGAGNGGATTTCCAGAAAGACCCGTTTTTTTTATACGGTTTATCTCCACTATCTGTGGCCAACTTTTTTCCTGTGTACATNTGACTAGGGATCCAATTTTTTATGTGCGCGTGTGTGCAGTCCAAATTTTACCTNTGAATGTTTATAGGAGNGTNTGGTCAGCATGAACTTTATTGGTAAACGTGGCATGAAGTAATCCCTGTTTGATGTTCTTTTTGCCATCCCCAAAATTGGAATGCAGTCTGTTGTACCTCTGCACATGGAGCCAGGTNTTGGGTATTATTTTTGTTTACACTGGGGCCTTATATGAAGTCTATCAAAGGGAACATCAGTCAGAGACATTTTTTGGGGGTTTTCTTGAAAATAAGTTCCAAAAGGAAATTTAAAATAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)