Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7976532.3                       2 END     2          50      100                hypothetical protein LOC494708 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7976532.3                       2 PI      86        671      909                hypothetical protein LOC494708 [Xenopus laevis]

 This cluster: approximate FL confidence score = 88%

 1012789884 Xl3.1-IMAGE:7976532.5 - 4 ESTs
                                                                       -400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7976532.5                                                                                                                                                                                                                                                                                                                                                                                                                 AATTGGAGTAAATCAAAACCTGTAGACAGGTGCAGCTCTAAATACAGGCACCTCTAGTTATAATGGTGCATACAATTTAGCCATTGACAATAAGCAGCTCTGGCAGCAGCATGTCGTGTTCTGTGGGAGCCCCAGATTTAGCTAATGAGGGTGACCCCGAATACATCAGCTGGAGAAATGAGAACTTGGATAGCAGCCTGGACGAAGTGCTGACATTTTCCCCAGACCTTGGGCTGTCACCGGTCACCTCTTTGTCTGGTAGCATGGGACTTCTGAACTGTGAGCACAGAATCAATCCAAGATGCAGGCTGAAGCTGTCTCCTGATTCTGAGAGTCCAAGCCCCACCGAGCCAACCAACCAGAGTCAAGCCTCCATGGAAACAAAATGTTTTACAGGTCTTCTTAATTTATCCACACCAAGGCCAGATAAAAACATCATTAAATCAAGTGACTCATCCTATGGAGTGAGGATCCGGCCGAAACAATCGACAAGAAGAGAACAAATGAGAGAACACGAGGAAAATGCTTCACACCCTGGAATACAAAAGAAATCTCGGATGAAGCTCTCAGACCTGTTTGATAGCGTGGAACACATTAATGAACAACCCAGGCAACAGTCTGAGAAAGCAAAAGTGAAGCAATTAGCCAAGCAGGCTAACGACAAAAAACAAGGGAAGAAAGGATCAGAAAACAAGAGACCTTTTGTCAATGGCATTAGCCCCCAGTTTCATACTGCAGAAATTGAAGATGATCAATTTATTGGAGACTTTTGTAAAACTTATTTATTACCTTTGGAAAAAGGGAAACATCAAGACCTTAAATATATTAGCTGCATCACTCTTGCCCGGCTTCTCAGAAGTGGNATATCAGATGTGGTGCNAGCATATCATATTGTGGATTGTCGATATCATA
                                                  Xl3.1-CHK-1012709498                                                                                                                                                                                                                                                                                                                                                                                                                       AGTAAATCAAAACCTGTAGACAGGTGCAGCTCTAAATACAGGCACCTCTAGTTATAATGGTGCATACAATTTAGCCATTGACAATAAGCAGCTCTGGCAGCAGCATGTCGTGTTCTGTGGGAGCCCCAGATTTAGCTAATGAGGGTGACCCCGAATACATCAGCTGGAGAAATGAGAACTTGGATAGCAGCCTGGACGAAGTGCTGACATTTTCCCCAGACCTTGGGCTGTCACCGGTCACCTCTTTGTCTGGTAGCATGGGACTTCTGAACTGTGAGCACAGAATCAATCCAAGATGCAGGCTGAAGCTGTCTCCTGATTCTGAGAGTCCAAGCCCCACCGAGCCAACCAACCAGAGTCAAGCCTCCATGGAAACAAAATGTTTTACAGGTCTTCTTAATTTATCCACACCAAGGCCAGATAAAAACATCATTAAATCAAGTGACTCATCCTATGGAGTGAGGATCCGGCCGAAACAATCGACAAGAAGAGAACAAATGAGAGAACACGAGGAAAATGCTTCACACCCTGGAATACAAAAGAAATCTCGGATGAAGCTCTCAGACCTGTTTGATAGCGTGGAACACATTAATGAACAACCCAGGCAACAGTCTGAGAAAGCAAAAGTGAAGCAATTAGCCAAGCAGGCTAACGACAAAAAACAAGGGAAGAAAGGATCAGAAAACAAGAGACCTTTTGTCAATGGCATTAGCCCCCAGTTTCATACTGCAGAAATTGAAGATGATCAATTTATTGGAGACTTTTGTAAAACTTATTTATTACCTTTGGAAAAAGGGAAACATCAAGACCTTAAATATATTAGCTGCATCACTCTTGCCCGGCTTCTCAGAAGTGGNATATCAGATGTGGTGCNAGCATATCATATTGTGGATTGTCGATATCATATGAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                      1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     374      18                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN     236      20                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR     110     143                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG     110      11                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 2e-007     XP_686314.2 PREDICTED: similar to M-phase inducer phosphatase 2 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bt ---- 4e-008     NP_001091465.1 cell division cycle 25C protein [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 1e-008     NP_033990.2 cell division cycle 25 homolog C [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 1e-008     XP_850186.1 PREDICTED: similar to cell division cycle 25B isoform 3 isoform 3 [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 1e-008     NP_001781.2 cell division cycle 25C protein isoform a [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Xt ---- 7e-009     NP_001107968.1 cell division cycle 25 homolog C [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ag ---- 3e-010     XP_319526.4 AGAP003301-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 3e-011     NP_524547.1 string CG1395-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Xl ==== 6e-095     NP_001088017.1 hypothetical protein LOC494708 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7976532.5                                                                                                                                                                                                                                                                                                                                                                                                                         TAA---------------------------TAA---------------------ATG------------TAG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2      seed Emb9 5g3  out                   IMAGE:7976532.5p                                                                                                                                                                                                                                                                                                                                                                                                                 AATTGGAGTAAATCAAAACCTGTAGACAGGTGCAGCTCTAAATACAGGCACCTCTAGTTATAATGGTGCATACAATTTAGCCATTGACAATAAGCAGCTCTGGCAGCAGCATGTCGTGTTCTGTGGGAGCCCCAGATTTAGCTAATGAGGGTGACCCCGAATACATCAGCTGGAGAAATGAGAACTTGGATAGCAGCCTGGACGAAGTGCTGACATTTTCCCCAGACCTTGGGCTGTCACCGGTCACCTCTTTGTCTGGTAGCATGGGACTTCTGAACTGTGAGCACAGAATCAATCCAAGATGCAGGCTGAAGCTGTCTCCTGATTCTGAGAGTCCAAGCCCCACCGAGCCAACCAACCAGAGTCAAGCCTCCATGGAAACAAAATGTTTTACAGGTCTTCTTAATTTATCCACACCAAGGCCAGATAAAAACATCATTAAATCAAGTGACTCATCCTATGGAGTGAGGATCCGGCCGAAACAATCGACAAGAAGAGAACAAATGAGAGAACACGAGGAAAATGCTTCACACCCTGGAATACAAAAGAAATCTCGGATGAAGCTCTCAGACCTGTTTGATAGCGTGGAACACATTAATGAACAACCCAGGCAACAGTCTGAGAAAGCAAAAGTGAAGCAATTAGCCAAGCAGGCTAACGACAAAAAACAGGGAAGAAAGGATCAGAAAACAAGAGACCTTTTGTCATGGCATTAGCCCCCAGTTCATACTGCAGAAATTGA
  5   1   2       bld Neu7 5g3  out                        XL041a15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCTCTAGTTATAATGGTGCATACAATTTAGCCCTGACAATAAGCAGCTCTGGCAGCAGCATGTCGTGTTCTGTGGGAGCCCCAGATTTAGCTAATGAGGGTGACCCCGAATACATCAGCTGGAGAAATGAGAACTCGGATAGCAGCCTGGACGAAGTGCTGACATTTTCCCCAGACCTTGGGCTGTCACCGGTCACCTCTTTGTCTGGTAGCATGGGACTTCTGAACTGTGAGCACAGAATCAATCCAAGATGCAGGCTGAAGCTGTCTCCTGATTCTGAGAGTCCAAGCCCCACCGAGCCAACCAACCAGAGTCAAGCCTCCATGGAAACAAAATGTTTTACAGGTCTTCTTAATTTATCCACACCAAGGCCAGATAAAAACATCATTAAATCAAGTGACTCATCCTATGGAGTGAGGATCCGGCCGAAACAATCGACAAGAAGAGAACAAATGAGAGAACACGAGGAAAATGCTTCACACCCTGGAATACAAAAGAAATCTCGGATGAAGCTCTCAG
  5   1   2       bld Emb4 5x3  out                   IMAGE:4959466.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAATTTAGCCATTGACAATAAGCAGCTCTGGCAGCAGCATGTCGTGTTCTGTGGGAGCCCCAGATTTAGCTAATGAGGGTGACCCCGAATACATCAGCTGGAGAAATGAGAACTTGGATAGCAGCCTGGACGAAGTGCTGACATTTTCCCCAGACCTTGGGCTGTCACCGGTCACCTCTTTGTCTGGTAGCATGGGACTTCTGAACTGTGATCACAGAATCAATCCAAGATGCAGGCTGAAGCTGTCTCCTGATTCTGAGAGTCCAAGCCCCCACCGAGCCAACCAACCAGAGTCAAGCCTCCATGGAAACAAAATGTTTTACAGGTCTTCTTAATTTATCCACACCAAGGCCAGATAAAAACATCATTAAATCAAGTGACTCATCCTATGGAGTGAGGATCCGGCCGAAACAATCGACAAGAAGAGAACAAATGAGAGAACACGAGGAAAATGCTTCACACCCTGGAATACAAAAGAAATCTCGGATGAAGCTCTCA
  5   1   2       bld Em10                            IMAGE:8317473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGAACTTGGATAGCAGCCTGGACGAAGTGCTGACATTTTCCCCAGACCTTGGGCTGTCACCGGTCACCTCTTTGTCTGGTAGCATGGGACTTCTGAACTGTGAGCACAGAATCAATCCAAGATGCAGGCTGAAGCTGTCTCCTGATTCTGAGAGTCCAAGCCCCACCGAGCCAACCAACCAGAGTCAAGCCTCCATGGAAACAAAATGTTTTACAGGTCTTCTTAATTTATCCACACCAAGGCCAGATAAAAACATCATTAAATCAAGTGACTCATCCTATGGAGTGAGGATCCGGCCGAAACAATCGACAAGAAGAGAACAAATGAGAGAACACGAGGAAAATGCTTCACACCCTGGAATACAAAAGAAATCTCGGATGAAGCTCTCAGACCTGTTTGATAGCGTGGAACACATTAATGAACAACCCAGGCAACAGTCTGAGAAAGCAAAAGTGAAGCAATTAGCCAAGCAGGCTAACGACAAAAAACAAGGGAAGAAAGGATCAGAAAACAAGAGACCTTTTGTCAATGGCATTAGCCCCCAGTTTCATACTGCAGAAATTGAAGATGATCAATTTATTGGAGACTTTTGTAAAACTTATTTATTACCTTTGGAAAAAGGGAAACATCAAGACCTTAAATATATTAGCTGCATCACTCTTGCCCGGCTTCTCAGAAGTGGNATATCAGATGTGGTGCNAGCATATCATATTGTGGATTGTCGATATCATATGAATATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)